Incidental Mutation 'R5772:Olfr1130'
ID445425
Institutional Source Beutler Lab
Gene Symbol Olfr1130
Ensembl Gene ENSMUSG00000059205
Gene Nameolfactory receptor 1130
SynonymsMOR264-4, GA_x6K02T2Q125-49112575-49113519
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87606212-87609852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87608173 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 262 (T262S)
Ref Sequence ENSEMBL: ENSMUSP00000078649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000213103] [ENSMUST00000216580]
Predicted Effect probably benign
Transcript: ENSMUST00000079711
AA Change: T262S

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: T262S

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213103
AA Change: T262S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000216580
AA Change: T262S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Olfr1130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Olfr1130 APN 2 87607979 missense probably damaging 1.00
IGL01310:Olfr1130 APN 2 87607508 missense possibly damaging 0.68
IGL02558:Olfr1130 APN 2 87607559 missense probably benign 0.00
R0323:Olfr1130 UTSW 2 87607497 missense probably benign
R0590:Olfr1130 UTSW 2 87607994 missense probably damaging 0.98
R0718:Olfr1130 UTSW 2 87607927 missense probably benign 0.08
R2445:Olfr1130 UTSW 2 87607958 missense probably damaging 0.99
R3408:Olfr1130 UTSW 2 87607876 missense probably benign 0.03
R4280:Olfr1130 UTSW 2 87608251 missense possibly damaging 0.90
R4491:Olfr1130 UTSW 2 87607392 start codon destroyed probably null 0.84
R4928:Olfr1130 UTSW 2 87608143 missense probably benign 0.06
R5033:Olfr1130 UTSW 2 87607711 missense probably damaging 1.00
R5061:Olfr1130 UTSW 2 87607832 missense probably benign 0.00
R5109:Olfr1130 UTSW 2 87607411 missense possibly damaging 0.64
R5109:Olfr1130 UTSW 2 87607975 missense possibly damaging 0.78
R6004:Olfr1130 UTSW 2 87607909 missense probably damaging 1.00
R6005:Olfr1130 UTSW 2 87608080 missense probably damaging 0.97
R6411:Olfr1130 UTSW 2 87607973 missense probably damaging 1.00
R6964:Olfr1130 UTSW 2 87607613 missense probably damaging 1.00
R7085:Olfr1130 UTSW 2 87607406 missense probably benign 0.00
X0060:Olfr1130 UTSW 2 87608042 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACCACCCATTCTCAAGCTGG -3'
(R):5'- TCATCATTTGTTCCAGAGCTCTAAGC -3'

Sequencing Primer
(F):5'- ATTCTCAAGCTGGCCTGCG -3'
(R):5'- GCTCTAAGCACTACTTGATACGTAAC -3'
Posted On2016-11-21