Incidental Mutation 'R5772:Sqor'
ID445427
Institutional Source Beutler Lab
Gene Symbol Sqor
Ensembl Gene ENSMUSG00000005803
Gene Namesulfide quinone oxidoreductase
Synonyms0610039J17Rik, Sqrdl, flavo-binding protein, 4930557M22Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122765237-122809569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122809341 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 175 (M175L)
Ref Sequence ENSEMBL: ENSMUSP00000135786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005953] [ENSMUST00000110506] [ENSMUST00000126403] [ENSMUST00000176343]
Predicted Effect probably benign
Transcript: ENSMUST00000005953
SMART Domains Protein: ENSMUSP00000005953
Gene: ENSMUSG00000005803

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 44 189 1.7e-11 PFAM
SCOP:d1fcda1 240 364 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110506
SMART Domains Protein: ENSMUSP00000106133
Gene: ENSMUSG00000005803

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 342 7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126403
SMART Domains Protein: ENSMUSP00000117575
Gene: ENSMUSG00000005803

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 192 8.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176343
AA Change: M175L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135786
Gene: ENSMUSG00000005803
AA Change: M175L

DomainStartEndE-ValueType
SCOP:d1fl2a1 25 132 6e-8 SMART
Meta Mutation Damage Score 0.6352 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function in mitochondria to catalyze the conversion of sulfide to persulfides, thereby decreasing toxic concencrations of sulfide. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Sqor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Sqor APN 2 122787543 missense probably damaging 0.97
IGL01544:Sqor APN 2 122792346 splice site probably benign
IGL02499:Sqor APN 2 122808087 missense possibly damaging 0.93
IGL02583:Sqor APN 2 122799770 missense probably damaging 0.98
IGL02732:Sqor APN 2 122799762 missense possibly damaging 0.76
IGL03137:Sqor APN 2 122808071 missense probably benign
H8786:Sqor UTSW 2 122792368 missense probably benign 0.10
R0126:Sqor UTSW 2 122798027 unclassified probably benign
R0410:Sqor UTSW 2 122787522 missense probably benign
R0502:Sqor UTSW 2 122798050 missense probably benign 0.04
R0709:Sqor UTSW 2 122799855 missense probably benign 0.38
R1486:Sqor UTSW 2 122807645 splice site probably null
R2001:Sqor UTSW 2 122798098 missense probably damaging 0.98
R2020:Sqor UTSW 2 122804107 critical splice donor site probably null
R2039:Sqor UTSW 2 122792404 critical splice donor site probably null
R2404:Sqor UTSW 2 122808023 missense probably benign
R4213:Sqor UTSW 2 122787498 missense probably damaging 1.00
R4909:Sqor UTSW 2 122785181 missense possibly damaging 0.82
R5630:Sqor UTSW 2 122809357 missense possibly damaging 0.71
R5659:Sqor UTSW 2 122787603 missense probably benign 0.02
R5728:Sqor UTSW 2 122809400 makesense probably null
R6527:Sqor UTSW 2 122809286 missense probably damaging 0.98
R6657:Sqor UTSW 2 122807594 missense possibly damaging 0.68
R6843:Sqor UTSW 2 122784980 missense probably benign 0.00
R6843:Sqor UTSW 2 122809295 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGTCAAAGCTAGGACTCATCG -3'
(R):5'- TTTCCAAAGACTCGTTCTGGGTTG -3'

Sequencing Primer
(F):5'- GTAGGTTGTTCCAGACATGACATCC -3'
(R):5'- GTCCACATGATAGCTATTCAGAGGC -3'
Posted On2016-11-21