Incidental Mutation 'R5772:Stx16'
ID445429
Institutional Source Beutler Lab
Gene Symbol Stx16
Ensembl Gene ENSMUSG00000027522
Gene Namesyntaxin 16
SynonymsSYN16, 6330500A18Rik, 5430410K23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174076308-174099771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 174093499 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 156 (G156R)
Ref Sequence ENSEMBL: ENSMUSP00000120279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044638] [ENSMUST00000087908] [ENSMUST00000134876] [ENSMUST00000147038] [ENSMUST00000155000]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044638
AA Change: G210R

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039543
Gene: ENSMUSG00000027522
AA Change: G210R

DomainStartEndE-ValueType
Blast:SynN 76 190 2e-20 BLAST
t_SNARE 227 294 9.13e-23 SMART
transmembrane domain 305 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087908
AA Change: G209R

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085218
Gene: ENSMUSG00000027522
AA Change: G209R

DomainStartEndE-ValueType
Pfam:Syntaxin 74 174 2.1e-15 PFAM
t_SNARE 226 293 9.13e-23 SMART
transmembrane domain 304 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134876
Predicted Effect probably damaging
Transcript: ENSMUST00000147038
AA Change: G156R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120279
Gene: ENSMUSG00000027522
AA Change: G156R

DomainStartEndE-ValueType
Pfam:Syntaxin 21 121 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155000
SMART Domains Protein: ENSMUSP00000119952
Gene: ENSMUSG00000027522

DomainStartEndE-ValueType
Pfam:Syntaxin 21 89 4.8e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156054
AA Change: G206R
SMART Domains Protein: ENSMUSP00000116618
Gene: ENSMUSG00000027522
AA Change: G206R

DomainStartEndE-ValueType
Blast:SynN 73 187 5e-21 BLAST
Pfam:SNARE 217 258 6.6e-18 PFAM
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and do not exhibit methylation abnormalities or develop a pseudohypoparathyroidism resistance phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Stx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Stx16 APN 2 174092409 missense probably damaging 1.00
IGL01626:Stx16 APN 2 174094020 missense probably damaging 1.00
IGL03052:Stx16 UTSW 2 174092438 missense probably benign 0.01
R0257:Stx16 UTSW 2 174096961 missense probably benign 0.39
R4929:Stx16 UTSW 2 174096928 missense possibly damaging 0.94
R5728:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5729:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5746:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5774:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5776:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R6147:Stx16 UTSW 2 174090687 missense probably damaging 1.00
R6837:Stx16 UTSW 2 174094002 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTTAATGCAAGCAAGGCTCCC -3'
(R):5'- TAGGCCTCTGTGACGACTAG -3'

Sequencing Primer
(F):5'- CTTTAGACTGTTTAGGGGCCTCC -3'
(R):5'- CTCTGTGACGACTAGGAGGG -3'
Posted On2016-11-21