Incidental Mutation 'R5772:Pdzrn3'
ID445443
Institutional Source Beutler Lab
Gene Symbol Pdzrn3
Ensembl Gene ENSMUSG00000035357
Gene NamePDZ domain containing RING finger 3
SynonymsLNX3, semaphorin cytoplasmic domain-associated protein 3A, Semcap3, 1110020C07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location101149609-101377897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101172314 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 351 (S351L)
Ref Sequence ENSEMBL: ENSMUSP00000075376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075994]
Predicted Effect probably benign
Transcript: ENSMUST00000075994
AA Change: S351L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075376
Gene: ENSMUSG00000035357
AA Change: S351L

DomainStartEndE-ValueType
RING 18 55 3.93e-3 SMART
low complexity region 198 214 N/A INTRINSIC
PDZ 257 339 3.38e-21 SMART
PDZ 429 504 3.86e-16 SMART
low complexity region 512 526 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 1020 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203474
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LNX (Ligand of Numb Protein-X) family of RING-type ubiquitin E3 ligases. This protein may function in vascular morphogenesis and the differentiation of adipocytes, osteoblasts and myoblasts. This protein may be targeted for degradation by the human papilloma virus E6 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Pdzrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Pdzrn3 APN 6 101354486 missense probably benign 0.01
IGL01511:Pdzrn3 APN 6 101153256 missense possibly damaging 0.66
IGL01554:Pdzrn3 APN 6 101150541 missense probably damaging 1.00
IGL02450:Pdzrn3 APN 6 101354500 missense probably damaging 1.00
IGL02505:Pdzrn3 APN 6 101151938 missense possibly damaging 0.94
IGL03061:Pdzrn3 APN 6 101151855 missense probably damaging 1.00
IGL03210:Pdzrn3 APN 6 101156952 missense possibly damaging 0.95
implevit_bonis UTSW 6 101151022 missense probably benign 0.15
tendency UTSW 6 101151428 missense probably damaging 1.00
PIT4581001:Pdzrn3 UTSW 6 101151503 missense probably benign 0.00
R0110:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0469:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0496:Pdzrn3 UTSW 6 101150570 missense possibly damaging 0.94
R0510:Pdzrn3 UTSW 6 101151053 missense probably damaging 1.00
R0883:Pdzrn3 UTSW 6 101155942 splice site probably null
R1171:Pdzrn3 UTSW 6 101150877 missense probably damaging 1.00
R1471:Pdzrn3 UTSW 6 101151512 missense possibly damaging 0.77
R1496:Pdzrn3 UTSW 6 101150969 missense probably benign 0.00
R1596:Pdzrn3 UTSW 6 101151005 missense probably benign 0.03
R2033:Pdzrn3 UTSW 6 101150954 missense probably damaging 1.00
R2068:Pdzrn3 UTSW 6 101150699 missense probably damaging 1.00
R2084:Pdzrn3 UTSW 6 101154295 missense probably benign 0.35
R2432:Pdzrn3 UTSW 6 101150791 missense probably damaging 1.00
R3727:Pdzrn3 UTSW 6 101156945 missense probably damaging 0.98
R3861:Pdzrn3 UTSW 6 101172371 missense possibly damaging 0.95
R4616:Pdzrn3 UTSW 6 101152009 missense probably damaging 0.99
R4967:Pdzrn3 UTSW 6 101151590 missense probably damaging 1.00
R5224:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5226:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5227:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5230:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5320:Pdzrn3 UTSW 6 101151103 missense probably damaging 1.00
R5414:Pdzrn3 UTSW 6 101153311 missense probably damaging 1.00
R5686:Pdzrn3 UTSW 6 101151428 missense probably damaging 1.00
R6026:Pdzrn3 UTSW 6 101362144 missense probably benign 0.40
R6213:Pdzrn3 UTSW 6 101377844 missense probably damaging 1.00
R6518:Pdzrn3 UTSW 6 101150514 makesense probably null
R6657:Pdzrn3 UTSW 6 101151022 missense probably benign 0.15
R6951:Pdzrn3 UTSW 6 101154192 critical splice donor site probably null
R7055:Pdzrn3 UTSW 6 101151774 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTCTTCACAGAAAGGAGGAAGAC -3'
(R):5'- ACATGCACGGATCTCTCCAG -3'

Sequencing Primer
(F):5'- GACAAACTTCCCAGAGTCCTTTGTG -3'
(R):5'- GCACGGATCTCTCCAGTTCCTG -3'
Posted On2016-11-21