Incidental Mutation 'R5772:Bcl2l14'
ID445445
Institutional Source Beutler Lab
Gene Symbol Bcl2l14
Ensembl Gene ENSMUSG00000030200
Gene NameBCL2-like 14 (apoptosis facilitator)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.044) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location134396318-134438736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134427399 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 183 (K183N)
Ref Sequence ENSEMBL: ENSMUSP00000132525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032321] [ENSMUST00000111960] [ENSMUST00000127865] [ENSMUST00000163589]
Predicted Effect probably damaging
Transcript: ENSMUST00000032321
AA Change: K183N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032321
Gene: ENSMUSG00000030200
AA Change: K183N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111960
AA Change: K183N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107591
Gene: ENSMUSG00000030200
AA Change: K183N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127865
SMART Domains Protein: ENSMUSP00000115608
Gene: ENSMUSG00000030200

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142612
Predicted Effect probably damaging
Transcript: ENSMUST00000163589
AA Change: K183N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132525
Gene: ENSMUSG00000030200
AA Change: K183N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205104
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. Overexpression of this gene has been shown to induce apoptosis in cells. Three alternatively spliced transcript variants encoding two distinct isoforms have been reported for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,253,988 W238R probably damaging Het
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in Bcl2l14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Bcl2l14 APN 6 134423865 missense probably damaging 1.00
IGL02451:Bcl2l14 APN 6 134423841 missense probably benign 0.18
R1115:Bcl2l14 UTSW 6 134432139 splice site probably benign
R1482:Bcl2l14 UTSW 6 134427302 missense probably damaging 1.00
R1952:Bcl2l14 UTSW 6 134432366 missense probably damaging 1.00
R3932:Bcl2l14 UTSW 6 134423808 missense probably damaging 0.98
R3933:Bcl2l14 UTSW 6 134423808 missense probably damaging 0.98
R6295:Bcl2l14 UTSW 6 134427407 missense probably benign 0.40
R7078:Bcl2l14 UTSW 6 134423823 missense probably damaging 0.98
X0062:Bcl2l14 UTSW 6 134427371 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTTTTATCTGAGGCTGGCC -3'
(R):5'- TCCATCGTGTTGCCTTCAAG -3'

Sequencing Primer
(F):5'- AGGCTGGCCTCTTCATCCTAAAC -3'
(R):5'- CCTTCAAGTGGGCTGAGATTCC -3'
Posted On2016-11-21