Incidental Mutation 'R5773:Prickle1'
ID445530
Institutional Source Beutler Lab
Gene Symbol Prickle1
Ensembl Gene ENSMUSG00000036158
Gene Nameprickle planar cell polarity protein 1
Synonyms1110058P22Rik, b2b019Clo, mpk1
MMRRC Submission 043372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5773 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location93499114-93595891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93508597 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 182 (H182N)
Ref Sequence ENSEMBL: ENSMUSP00000104878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048982] [ENSMUST00000109255]
Predicted Effect probably damaging
Transcript: ENSMUST00000048982
AA Change: H182N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049204
Gene: ENSMUSG00000036158
AA Change: H182N

DomainStartEndE-ValueType
Pfam:PET 16 116 2.2e-46 PFAM
LIM 125 182 1.73e-9 SMART
LIM 190 242 1.13e-13 SMART
LIM 250 305 2.37e-7 SMART
low complexity region 314 343 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
low complexity region 758 776 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109255
AA Change: H182N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104878
Gene: ENSMUSG00000036158
AA Change: H182N

DomainStartEndE-ValueType
Pfam:PET 13 118 3.7e-46 PFAM
LIM 125 182 1.73e-9 SMART
LIM 190 242 1.13e-13 SMART
LIM 250 305 2.37e-7 SMART
low complexity region 314 343 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
low complexity region 758 776 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor that may be a negative regulator of the Wnt/beta-catenin signaling pathway. The encoded protein localizes to the nuclear membrane and has been implicated in the nuclear trafficking of the transcription repressors REST/NRSF and REST4. Mutations in this gene have been linked to progressive myoclonus epilepsy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous null or point mutations result in decreased seizure threshold. Homozygous null mice display early embryonic lethality associated with altered epiblast apical-basal polarity, failed anterior migration of the distal visceral endoderm, and lackof mesoderm and primitive streak formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,574,694 probably null Het
Akna C T 4: 63,395,070 S272N probably benign Het
Ap2m1 T C 16: 20,543,390 V416A probably damaging Het
Atp7b A G 8: 22,027,863 F320L probably benign Het
Brd1 T C 15: 88,689,549 K1116E probably benign Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Cdh4 A G 2: 179,885,996 Y503C probably damaging Het
Cfb C A 17: 34,857,272 E166* probably null Het
Cmtm1 A T 8: 104,305,176 F90I probably damaging Het
Col1a1 A T 11: 94,939,429 K160N probably benign Het
Cradd T C 10: 95,175,961 I106V probably benign Het
Defa17 A G 8: 21,656,558 R67G probably damaging Het
Dgkh T C 14: 78,595,455 N765S probably damaging Het
Dock5 A G 14: 67,796,058 V954A possibly damaging Het
Eif2d A G 1: 131,158,303 probably null Het
Epg5 T A 18: 77,960,825 F683I probably damaging Het
Fhad1 T G 4: 141,929,570 K91T probably damaging Het
Fut11 A T 14: 20,698,315 D476V probably damaging Het
Gldn T C 9: 54,334,491 probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8674 T A 13: 49,901,876 noncoding transcript Het
Gtpbp6 C A 5: 110,106,891 E168D possibly damaging Het
Hinfp T A 9: 44,299,236 H163L probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Ing3 T A 6: 21,971,835 C368S probably damaging Het
Itih1 A G 14: 30,935,399 V489A possibly damaging Het
Itsn2 T C 12: 4,707,089 L1393P probably damaging Het
Kcnj13 T C 1: 87,386,667 T278A probably damaging Het
Kntc1 G A 5: 123,794,157 R1338Q probably damaging Het
Lipi T A 16: 75,573,925 T135S probably damaging Het
Map7 A G 10: 20,246,644 K152R probably benign Het
Mmp24 A G 2: 155,799,909 Y219C probably damaging Het
Nup188 T C 2: 30,322,196 V565A possibly damaging Het
Nup210 T C 6: 91,085,883 K265E probably damaging Het
Olfr1331 A G 4: 118,869,521 T247A probably damaging Het
Pcdha6 A T 18: 36,969,590 H612L probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pld2 G T 11: 70,555,932 S778I probably damaging Het
Ppef2 A C 5: 92,250,561 Y33D probably damaging Het
Ppfibp2 A T 7: 107,685,872 T129S possibly damaging Het
R3hdm2 T A 10: 127,444,303 probably benign Het
Rbm12b1 A T 4: 12,145,765 E579V probably damaging Het
Rsf1 GGC GGCGGCGGCTGC 7: 97,579,933 probably benign Het
Slc1a6 T G 10: 78,793,277 probably null Het
Slc27a6 G T 18: 58,582,173 A283S probably damaging Het
Spats2l T A 1: 57,879,549 N27K possibly damaging Het
Srgap1 T C 10: 121,896,709 M155V probably benign Het
Stxbp5l C A 16: 37,208,097 A535S probably damaging Het
Svep1 C A 4: 58,099,985 C1353F possibly damaging Het
Taar4 T A 10: 23,961,158 I222N probably damaging Het
Tlr6 A G 5: 64,954,503 F354L probably benign Het
Trp53bp1 A G 2: 121,243,914 S452P probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Usp42 A T 5: 143,713,712 M1264K probably benign Het
Zfp865 A T 7: 5,034,694 probably benign Het
Zfyve26 A T 12: 79,287,737 L169Q probably damaging Het
Zmym4 A T 4: 126,905,370 N383K possibly damaging Het
Other mutations in Prickle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Prickle1 APN 15 93500781 missense probably benign 0.29
IGL01641:Prickle1 APN 15 93500572 missense probably benign 0.05
IGL01917:Prickle1 APN 15 93503527 missense probably damaging 0.99
IGL02124:Prickle1 APN 15 93503146 missense probably damaging 1.00
IGL02754:Prickle1 APN 15 93501153 missense possibly damaging 0.94
P0028:Prickle1 UTSW 15 93500902 missense probably damaging 1.00
R0134:Prickle1 UTSW 15 93510777 missense possibly damaging 0.63
R0189:Prickle1 UTSW 15 93503019 nonsense probably null
R0225:Prickle1 UTSW 15 93510777 missense possibly damaging 0.63
R0556:Prickle1 UTSW 15 93500781 missense probably benign 0.29
R1144:Prickle1 UTSW 15 93512461 missense probably damaging 0.99
R1440:Prickle1 UTSW 15 93505074 missense possibly damaging 0.85
R1458:Prickle1 UTSW 15 93500638 missense probably damaging 1.00
R2420:Prickle1 UTSW 15 93503637 missense probably damaging 1.00
R2656:Prickle1 UTSW 15 93503370 missense probably benign 0.32
R2864:Prickle1 UTSW 15 93509278 missense probably damaging 0.99
R4301:Prickle1 UTSW 15 93508636 missense possibly damaging 0.82
R4912:Prickle1 UTSW 15 93500548 missense probably benign 0.00
R5085:Prickle1 UTSW 15 93500902 missense probably damaging 1.00
R5836:Prickle1 UTSW 15 93503017 nonsense probably null
R5902:Prickle1 UTSW 15 93510672 missense probably null 0.82
R7022:Prickle1 UTSW 15 93500871 missense possibly damaging 0.82
X0066:Prickle1 UTSW 15 93503194 missense probably benign 0.00
X0067:Prickle1 UTSW 15 93508681 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CATCATGGGCAAGCAGAAGC -3'
(R):5'- GTGGGAAATGCTGAAAACCC -3'

Sequencing Primer
(F):5'- GGGCAGCTTTATCTTAAACATACCC -3'
(R):5'- CCCAGTAATTTAGGTGAAGGACC -3'
Posted On2016-11-21