Incidental Mutation 'R5773:Epg5'
ID445536
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission 043372-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R5773 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77960825 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 683 (F683I)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect probably damaging
Transcript: ENSMUST00000044622
AA Change: F683I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: F683I

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,574,694 probably null Het
Akna C T 4: 63,395,070 S272N probably benign Het
Ap2m1 T C 16: 20,543,390 V416A probably damaging Het
Atp7b A G 8: 22,027,863 F320L probably benign Het
Brd1 T C 15: 88,689,549 K1116E probably benign Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Cdh4 A G 2: 179,885,996 Y503C probably damaging Het
Cfb C A 17: 34,857,272 E166* probably null Het
Cmtm1 A T 8: 104,305,176 F90I probably damaging Het
Col1a1 A T 11: 94,939,429 K160N probably benign Het
Cradd T C 10: 95,175,961 I106V probably benign Het
Defa17 A G 8: 21,656,558 R67G probably damaging Het
Dgkh T C 14: 78,595,455 N765S probably damaging Het
Dock5 A G 14: 67,796,058 V954A possibly damaging Het
Eif2d A G 1: 131,158,303 probably null Het
Fhad1 T G 4: 141,929,570 K91T probably damaging Het
Fut11 A T 14: 20,698,315 D476V probably damaging Het
Gldn T C 9: 54,334,491 probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8674 T A 13: 49,901,876 noncoding transcript Het
Gtpbp6 C A 5: 110,106,891 E168D possibly damaging Het
Hinfp T A 9: 44,299,236 H163L probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Ing3 T A 6: 21,971,835 C368S probably damaging Het
Itih1 A G 14: 30,935,399 V489A possibly damaging Het
Itsn2 T C 12: 4,707,089 L1393P probably damaging Het
Kcnj13 T C 1: 87,386,667 T278A probably damaging Het
Kntc1 G A 5: 123,794,157 R1338Q probably damaging Het
Lipi T A 16: 75,573,925 T135S probably damaging Het
Map7 A G 10: 20,246,644 K152R probably benign Het
Mmp24 A G 2: 155,799,909 Y219C probably damaging Het
Nup188 T C 2: 30,322,196 V565A possibly damaging Het
Nup210 T C 6: 91,085,883 K265E probably damaging Het
Olfr1331 A G 4: 118,869,521 T247A probably damaging Het
Pcdha6 A T 18: 36,969,590 H612L probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pld2 G T 11: 70,555,932 S778I probably damaging Het
Ppef2 A C 5: 92,250,561 Y33D probably damaging Het
Ppfibp2 A T 7: 107,685,872 T129S possibly damaging Het
Prickle1 G T 15: 93,508,597 H182N probably damaging Het
R3hdm2 T A 10: 127,444,303 probably benign Het
Rbm12b1 A T 4: 12,145,765 E579V probably damaging Het
Rsf1 GGC GGCGGCGGCTGC 7: 97,579,933 probably benign Het
Slc1a6 T G 10: 78,793,277 probably null Het
Slc27a6 G T 18: 58,582,173 A283S probably damaging Het
Spats2l T A 1: 57,879,549 N27K possibly damaging Het
Srgap1 T C 10: 121,896,709 M155V probably benign Het
Stxbp5l C A 16: 37,208,097 A535S probably damaging Het
Svep1 C A 4: 58,099,985 C1353F possibly damaging Het
Taar4 T A 10: 23,961,158 I222N probably damaging Het
Tlr6 A G 5: 64,954,503 F354L probably benign Het
Trp53bp1 A G 2: 121,243,914 S452P probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Usp42 A T 5: 143,713,712 M1264K probably benign Het
Zfp865 A T 7: 5,034,694 probably benign Het
Zfyve26 A T 12: 79,287,737 L169Q probably damaging Het
Zmym4 A T 4: 126,905,370 N383K possibly damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense not run
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGAGCGTGTTACTCCTCC -3'
(R):5'- GGTCACAACTGGTTTAAGTACAACAC -3'

Sequencing Primer
(F):5'- ACTCCTCCTCGTGTGATGTAAAGG -3'
(R):5'- TGGTTTAAGTACAACACAGATATGGG -3'
Posted On2016-11-21