Incidental Mutation 'R5774:Spocd1'
ID445550
Institutional Source Beutler Lab
Gene Symbol Spocd1
Ensembl Gene ENSMUSG00000028784
Gene NameSPOC domain containing 1
SynonymsOTTMUSG00000009522
MMRRC Submission 043373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5774 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129929249-129957115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129951786 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 480 (S480T)
Ref Sequence ENSEMBL: ENSMUSP00000081284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084263] [ENSMUST00000128007]
Predicted Effect probably benign
Transcript: ENSMUST00000084263
AA Change: S480T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000081284
Gene: ENSMUSG00000028784
AA Change: S480T

DomainStartEndE-ValueType
Pfam:TFIIS_M 1 105 1.7e-24 PFAM
Blast:PAC 123 163 4e-7 BLAST
Pfam:SPOC 247 350 1e-22 PFAM
low complexity region 454 467 N/A INTRINSIC
low complexity region 559 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128007
AA Change: S124T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000118383
Gene: ENSMUSG00000028784
AA Change: S124T

DomainStartEndE-ValueType
Pfam:TFIIS_M 5 113 3.6e-28 PFAM
Blast:PAC 129 157 6e-7 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TFIIS family of transcription factors. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,531,667 L62M probably damaging Het
Abcc9 G A 6: 142,628,559 T949I probably damaging Het
Adam4 C T 12: 81,420,686 S387N probably damaging Het
Akap11 T C 14: 78,510,967 S1327G probably damaging Het
Arhgap1 A G 2: 91,654,108 T12A possibly damaging Het
Arhgap28 A G 17: 67,881,492 S228P possibly damaging Het
Atp6v1b2 A T 8: 69,101,961 D106V probably damaging Het
Atp9b T G 18: 80,933,932 D3A probably damaging Het
BC030867 T A 11: 102,255,669 I257N possibly damaging Het
Bptf A G 11: 107,111,137 F383S probably damaging Het
Cdh24 T C 14: 54,639,057 T104A probably damaging Het
Cep55 A G 19: 38,062,655 E171G probably damaging Het
Cntrl T A 2: 35,162,861 M1126K probably benign Het
Cts3 A T 13: 61,568,370 I59N probably damaging Het
Ddx52 A G 11: 83,946,134 I150M probably damaging Het
Dennd6a T C 14: 26,579,819 V62A probably benign Het
Dpep1 C A 8: 123,199,982 D211E probably damaging Het
Gm1527 T C 3: 28,918,090 V452A probably benign Het
Hmcn2 T C 2: 31,409,135 V2831A possibly damaging Het
Hydin G T 8: 110,571,915 E3722* probably null Het
Il17a A G 1: 20,733,773 S131G probably benign Het
Ing3 C T 6: 21,967,689 P119S probably benign Het
Larp4b T A 13: 9,170,643 probably null Het
Lca5l G T 16: 96,176,061 Q177K probably benign Het
Lrrc61 C T 6: 48,568,199 probably benign Het
Man2a2 T C 7: 80,368,358 Y188C probably damaging Het
Mdk T C 2: 91,931,224 E36G probably damaging Het
Mmp12 T C 9: 7,354,823 I272T possibly damaging Het
Myh4 A T 11: 67,253,208 K1135* probably null Het
Nup188 T A 2: 30,301,048 Y96N probably damaging Het
Olfr1080 A T 2: 86,554,007 V39E possibly damaging Het
Pank4 G A 4: 154,980,662 G806D probably damaging Het
Parp14 T C 16: 35,858,410 Y396C probably damaging Het
Pcdhb8 T A 18: 37,356,685 I472N probably damaging Het
Sema3a T A 5: 13,523,164 W220R probably damaging Het
Slc35g3 A G 11: 69,760,298 V309A probably damaging Het
Slc6a6 A G 6: 91,745,000 M394V probably damaging Het
Specc1l G A 10: 75,245,400 R210H probably damaging Het
Sptbn5 T A 2: 120,050,458 noncoding transcript Het
Srrm2 A G 17: 23,818,275 probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Topbp1 A G 9: 103,328,499 K779E probably benign Het
Trank1 T A 9: 111,391,226 F2344I probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Ube4a G A 9: 44,953,097 P66L probably damaging Het
Utp6 A T 11: 79,953,598 F200L probably benign Het
Vmn2r117 A T 17: 23,477,202 H410Q probably damaging Het
Vps33b C T 7: 80,285,340 H344Y probably benign Het
Xpo5 C T 17: 46,241,846 R1145* probably null Het
Zbed4 T A 15: 88,781,649 F640Y possibly damaging Het
Zfp618 C T 4: 63,132,562 R527C probably damaging Het
Other mutations in Spocd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Spocd1 APN 4 129953587 missense probably damaging 0.99
IGL02332:Spocd1 APN 4 129949092 missense probably damaging 1.00
IGL02796:Spocd1 APN 4 129947755 intron probably benign
R0005:Spocd1 UTSW 4 129956778 missense possibly damaging 0.73
R0499:Spocd1 UTSW 4 129955470 missense possibly damaging 0.56
R0939:Spocd1 UTSW 4 129948870 missense possibly damaging 0.93
R1128:Spocd1 UTSW 4 129956806 missense possibly damaging 0.57
R5747:Spocd1 UTSW 4 129954945 missense probably damaging 1.00
R5872:Spocd1 UTSW 4 129956461 missense probably damaging 0.99
R5887:Spocd1 UTSW 4 129948959 missense probably damaging 1.00
R6185:Spocd1 UTSW 4 129956449 missense probably benign 0.02
R6198:Spocd1 UTSW 4 129955415 missense probably damaging 1.00
R6245:Spocd1 UTSW 4 129957108 unclassified probably null
R6412:Spocd1 UTSW 4 129953572 missense probably benign 0.44
R6804:Spocd1 UTSW 4 129953630 nonsense probably null
R6884:Spocd1 UTSW 4 129955404 unclassified probably benign
R6898:Spocd1 UTSW 4 129956512 unclassified probably benign
R7090:Spocd1 UTSW 4 129953898 missense
Predicted Primers PCR Primer
(F):5'- TCTTAGAGGAGGCAGGACTTC -3'
(R):5'- TAAACATGGGGCCCACAGAG -3'

Sequencing Primer
(F):5'- CTGGCTTTCTGAGTGAACAGAGAG -3'
(R):5'- CCCACAGAGTAGGCAATGGC -3'
Posted On2016-11-21