Incidental Mutation 'R5774:Sema3a'
ID 445552
Institutional Source Beutler Lab
Gene Symbol Sema3a
Ensembl Gene ENSMUSG00000028883
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms Semad, collapsin-1, SemD, sema III, semaphorin III
MMRRC Submission 043373-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R5774 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 13175381-13652533 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13573131 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 220 (W220R)
Ref Sequence ENSEMBL: ENSMUSP00000128153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000137798]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030714
AA Change: W220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883
AA Change: W220R

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095012
AA Change: W220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883
AA Change: W220R

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137798
AA Change: W220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883
AA Change: W220R

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197609
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,581,668 (GRCm39) L62M probably damaging Het
Abcc9 G A 6: 142,574,285 (GRCm39) T949I probably damaging Het
Adam4 C T 12: 81,467,460 (GRCm39) S387N probably damaging Het
Akap11 T C 14: 78,748,407 (GRCm39) S1327G probably damaging Het
Arhgap1 A G 2: 91,484,453 (GRCm39) T12A possibly damaging Het
Arhgap28 A G 17: 68,188,487 (GRCm39) S228P possibly damaging Het
Atp6v1b2 A T 8: 69,554,613 (GRCm39) D106V probably damaging Het
Atp9b T G 18: 80,977,147 (GRCm39) D3A probably damaging Het
Bptf A G 11: 107,001,963 (GRCm39) F383S probably damaging Het
Cdh24 T C 14: 54,876,514 (GRCm39) T104A probably damaging Het
Cep55 A G 19: 38,051,103 (GRCm39) E171G probably damaging Het
Cntrl T A 2: 35,052,873 (GRCm39) M1126K probably benign Het
Cts3 A T 13: 61,716,184 (GRCm39) I59N probably damaging Het
Ddx52 A G 11: 83,836,960 (GRCm39) I150M probably damaging Het
Dennd6a T C 14: 26,300,974 (GRCm39) V62A probably benign Het
Dpep1 C A 8: 123,926,721 (GRCm39) D211E probably damaging Het
Gm1527 T C 3: 28,972,239 (GRCm39) V452A probably benign Het
Hmcn2 T C 2: 31,299,147 (GRCm39) V2831A possibly damaging Het
Hrob T A 11: 102,146,495 (GRCm39) I257N possibly damaging Het
Hydin G T 8: 111,298,547 (GRCm39) E3722* probably null Het
Il17a A G 1: 20,803,997 (GRCm39) S131G probably benign Het
Ing3 C T 6: 21,967,688 (GRCm39) P119S probably benign Het
Larp4b T A 13: 9,220,679 (GRCm39) probably null Het
Lca5l G T 16: 95,977,261 (GRCm39) Q177K probably benign Het
Lrrc61 C T 6: 48,545,133 (GRCm39) probably benign Het
Man2a2 T C 7: 80,018,106 (GRCm39) Y188C probably damaging Het
Mdk T C 2: 91,761,569 (GRCm39) E36G probably damaging Het
Mmp12 T C 9: 7,354,823 (GRCm39) I272T possibly damaging Het
Myh4 A T 11: 67,144,034 (GRCm39) K1135* probably null Het
Nup188 T A 2: 30,191,060 (GRCm39) Y96N probably damaging Het
Or8k33 A T 2: 86,384,351 (GRCm39) V39E possibly damaging Het
Pank4 G A 4: 155,065,119 (GRCm39) G806D probably damaging Het
Parp14 T C 16: 35,678,780 (GRCm39) Y396C probably damaging Het
Pcdhb8 T A 18: 37,489,738 (GRCm39) I472N probably damaging Het
Slc35g3 A G 11: 69,651,124 (GRCm39) V309A probably damaging Het
Slc6a6 A G 6: 91,721,981 (GRCm39) M394V probably damaging Het
Specc1l G A 10: 75,081,234 (GRCm39) R210H probably damaging Het
Spocd1 T A 4: 129,845,579 (GRCm39) S480T probably benign Het
Sptbn5 T A 2: 119,880,939 (GRCm39) noncoding transcript Het
Srrm2 A G 17: 24,037,249 (GRCm39) probably benign Het
Stx16 G A 2: 173,935,292 (GRCm39) G156R probably damaging Het
Topbp1 A G 9: 103,205,698 (GRCm39) K779E probably benign Het
Trank1 T A 9: 111,220,294 (GRCm39) F2344I probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,980,329 (GRCm39) probably null Het
Ube4a G A 9: 44,864,395 (GRCm39) P66L probably damaging Het
Utp6 A T 11: 79,844,424 (GRCm39) F200L probably benign Het
Vmn2r117 A T 17: 23,696,176 (GRCm39) H410Q probably damaging Het
Vps33b C T 7: 79,935,088 (GRCm39) H344Y probably benign Het
Xpo5 C T 17: 46,552,772 (GRCm39) R1145* probably null Het
Zbed4 T A 15: 88,665,852 (GRCm39) F640Y possibly damaging Het
Zfp618 C T 4: 63,050,799 (GRCm39) R527C probably damaging Het
Other mutations in Sema3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Sema3a APN 5 13,523,433 (GRCm39) missense probably damaging 1.00
IGL01783:Sema3a APN 5 13,611,767 (GRCm39) missense probably damaging 1.00
IGL02423:Sema3a APN 5 13,615,776 (GRCm39) missense probably damaging 1.00
IGL02728:Sema3a APN 5 13,615,881 (GRCm39) missense probably damaging 1.00
IGL02739:Sema3a APN 5 13,501,128 (GRCm39) missense probably damaging 1.00
IGL02987:Sema3a APN 5 13,615,863 (GRCm39) missense probably damaging 1.00
IGL03106:Sema3a APN 5 13,649,456 (GRCm39) missense probably damaging 1.00
R0055:Sema3a UTSW 5 13,450,004 (GRCm39) missense possibly damaging 0.92
R0334:Sema3a UTSW 5 13,607,268 (GRCm39) missense probably damaging 0.99
R0684:Sema3a UTSW 5 13,606,494 (GRCm39) critical splice acceptor site probably null
R0750:Sema3a UTSW 5 13,607,092 (GRCm39) critical splice donor site probably null
R1204:Sema3a UTSW 5 13,573,142 (GRCm39) critical splice donor site probably benign
R1221:Sema3a UTSW 5 13,566,190 (GRCm39) missense probably benign
R1484:Sema3a UTSW 5 13,523,407 (GRCm39) missense probably damaging 1.00
R1663:Sema3a UTSW 5 13,607,092 (GRCm39) critical splice donor site probably null
R2079:Sema3a UTSW 5 13,501,098 (GRCm39) missense possibly damaging 0.95
R4165:Sema3a UTSW 5 13,523,364 (GRCm39) critical splice acceptor site probably null
R4596:Sema3a UTSW 5 13,620,125 (GRCm39) missense probably damaging 1.00
R4867:Sema3a UTSW 5 13,501,208 (GRCm39) missense probably benign 0.05
R4904:Sema3a UTSW 5 13,631,066 (GRCm39) missense probably damaging 1.00
R5107:Sema3a UTSW 5 13,627,572 (GRCm39) nonsense probably null
R5327:Sema3a UTSW 5 13,649,357 (GRCm39) missense probably benign 0.25
R5343:Sema3a UTSW 5 13,523,373 (GRCm39) missense probably damaging 1.00
R5430:Sema3a UTSW 5 13,615,730 (GRCm39) missense probably damaging 0.97
R5604:Sema3a UTSW 5 13,523,487 (GRCm39) critical splice donor site probably null
R6057:Sema3a UTSW 5 13,615,832 (GRCm39) missense probably damaging 1.00
R6110:Sema3a UTSW 5 13,630,969 (GRCm39) missense probably damaging 1.00
R6132:Sema3a UTSW 5 13,573,142 (GRCm39) critical splice donor site probably null
R6310:Sema3a UTSW 5 13,606,986 (GRCm39) missense probably damaging 1.00
R6754:Sema3a UTSW 5 13,649,243 (GRCm39) missense possibly damaging 0.94
R6788:Sema3a UTSW 5 13,647,584 (GRCm39) missense possibly damaging 0.95
R6878:Sema3a UTSW 5 13,505,511 (GRCm39) missense possibly damaging 0.88
R7411:Sema3a UTSW 5 13,566,230 (GRCm39) nonsense probably null
R7501:Sema3a UTSW 5 13,607,008 (GRCm39) missense probably damaging 1.00
R7514:Sema3a UTSW 5 13,573,093 (GRCm39) missense probably benign 0.03
R7531:Sema3a UTSW 5 13,615,805 (GRCm39) missense probably damaging 1.00
R7538:Sema3a UTSW 5 13,611,787 (GRCm39) missense probably benign 0.42
R7970:Sema3a UTSW 5 13,649,375 (GRCm39) missense possibly damaging 0.93
R8121:Sema3a UTSW 5 13,649,215 (GRCm39) missense probably damaging 1.00
R8283:Sema3a UTSW 5 13,450,030 (GRCm39) missense probably damaging 0.98
R8434:Sema3a UTSW 5 13,523,487 (GRCm39) critical splice donor site probably null
R8918:Sema3a UTSW 5 13,573,099 (GRCm39) missense probably damaging 1.00
R9500:Sema3a UTSW 5 13,615,854 (GRCm39) missense possibly damaging 0.88
X0064:Sema3a UTSW 5 13,631,066 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCTTTTAGGACCCAAGG -3'
(R):5'- GTGAGAAACTTGATATTTGGCCC -3'

Sequencing Primer
(F):5'- GCTTTTAGGACCCAAGGATGAAATAC -3'
(R):5'- TTGGCCCAAAACAAATACTTCCTTAG -3'
Posted On 2016-11-21