Incidental Mutation 'R5774:Arhgap28'
ID445590
Institutional Source Beutler Lab
Gene Symbol Arhgap28
Ensembl Gene ENSMUSG00000024043
Gene NameRho GTPase activating protein 28
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R5774 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location67842713-68004120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67881492 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 228 (S228P)
Ref Sequence ENSEMBL: ENSMUSP00000024840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024840
AA Change: S228P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043
AA Change: S228P

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
RhoGAP 400 578 1.41e-34 SMART
Blast:RhoGAP 583 612 2e-7 BLAST
Blast:RhoGAP 640 681 9e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000163865
AA Change: S178P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043
AA Change: S178P

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 527 7.1e-31 SMART
Blast:RhoGAP 532 561 1e-7 BLAST
Blast:RhoGAP 589 630 8e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000164647
AA Change: S178P

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043
AA Change: S178P

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 528 1.41e-34 SMART
Blast:RhoGAP 533 562 1e-7 BLAST
Blast:RhoGAP 590 631 8e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170581
SMART Domains Protein: ENSMUSP00000131903
Gene: ENSMUSG00000024043

DomainStartEndE-ValueType
Blast:RhoGAP 151 213 1e-33 BLAST
SCOP:d1tx4a_ 182 235 1e-10 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,531,667 L62M probably damaging Het
Abcc9 G A 6: 142,628,559 T949I probably damaging Het
Adam4 C T 12: 81,420,686 S387N probably damaging Het
Akap11 T C 14: 78,510,967 S1327G probably damaging Het
Arhgap1 A G 2: 91,654,108 T12A possibly damaging Het
Atp6v1b2 A T 8: 69,101,961 D106V probably damaging Het
Atp9b T G 18: 80,933,932 D3A probably damaging Het
BC030867 T A 11: 102,255,669 I257N possibly damaging Het
Bptf A G 11: 107,111,137 F383S probably damaging Het
Cdh24 T C 14: 54,639,057 T104A probably damaging Het
Cep55 A G 19: 38,062,655 E171G probably damaging Het
Cntrl T A 2: 35,162,861 M1126K probably benign Het
Cts3 A T 13: 61,568,370 I59N probably damaging Het
Ddx52 A G 11: 83,946,134 I150M probably damaging Het
Dennd6a T C 14: 26,579,819 V62A probably benign Het
Dpep1 C A 8: 123,199,982 D211E probably damaging Het
Gm1527 T C 3: 28,918,090 V452A probably benign Het
Hmcn2 T C 2: 31,409,135 V2831A possibly damaging Het
Hydin G T 8: 110,571,915 E3722* probably null Het
Il17a A G 1: 20,733,773 S131G probably benign Het
Ing3 C T 6: 21,967,689 P119S probably benign Het
Larp4b T A 13: 9,170,643 probably null Het
Lca5l G T 16: 96,176,061 Q177K probably benign Het
Lrrc61 C T 6: 48,568,199 probably benign Het
Man2a2 T C 7: 80,368,358 Y188C probably damaging Het
Mdk T C 2: 91,931,224 E36G probably damaging Het
Mmp12 T C 9: 7,354,823 I272T possibly damaging Het
Myh4 A T 11: 67,253,208 K1135* probably null Het
Nup188 T A 2: 30,301,048 Y96N probably damaging Het
Olfr1080 A T 2: 86,554,007 V39E possibly damaging Het
Pank4 G A 4: 154,980,662 G806D probably damaging Het
Parp14 T C 16: 35,858,410 Y396C probably damaging Het
Pcdhb8 T A 18: 37,356,685 I472N probably damaging Het
Sema3a T A 5: 13,523,164 W220R probably damaging Het
Slc35g3 A G 11: 69,760,298 V309A probably damaging Het
Slc6a6 A G 6: 91,745,000 M394V probably damaging Het
Specc1l G A 10: 75,245,400 R210H probably damaging Het
Spocd1 T A 4: 129,951,786 S480T probably benign Het
Sptbn5 T A 2: 120,050,458 noncoding transcript Het
Srrm2 A G 17: 23,818,275 probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Topbp1 A G 9: 103,328,499 K779E probably benign Het
Trank1 T A 9: 111,391,226 F2344I probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Ube4a G A 9: 44,953,097 P66L probably damaging Het
Utp6 A T 11: 79,953,598 F200L probably benign Het
Vmn2r117 A T 17: 23,477,202 H410Q probably damaging Het
Vps33b C T 7: 80,285,340 H344Y probably benign Het
Xpo5 C T 17: 46,241,846 R1145* probably null Het
Zbed4 T A 15: 88,781,649 F640Y possibly damaging Het
Zfp618 C T 4: 63,132,562 R527C probably damaging Het
Other mutations in Arhgap28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Arhgap28 APN 17 67845801 missense probably damaging 1.00
IGL01388:Arhgap28 APN 17 67853039 unclassified probably benign
IGL01560:Arhgap28 APN 17 67896071 missense probably damaging 1.00
IGL01578:Arhgap28 APN 17 67858200 missense probably benign 0.00
IGL01650:Arhgap28 APN 17 67873132 missense probably damaging 0.97
IGL02383:Arhgap28 APN 17 67896089 missense probably benign 0.00
IGL02403:Arhgap28 APN 17 67873159 missense possibly damaging 0.87
IGL02652:Arhgap28 APN 17 67884800 missense probably benign 0.00
IGL03102:Arhgap28 APN 17 67896236 missense probably damaging 1.00
IGL03209:Arhgap28 APN 17 67868956 missense probably damaging 1.00
IGL03306:Arhgap28 APN 17 67852935 missense probably damaging 1.00
K3955:Arhgap28 UTSW 17 68004006 missense probably damaging 0.98
R0135:Arhgap28 UTSW 17 67864588 missense probably damaging 1.00
R0309:Arhgap28 UTSW 17 67901429 missense probably benign 0.13
R0385:Arhgap28 UTSW 17 67864606 missense probably damaging 1.00
R0412:Arhgap28 UTSW 17 67896258 missense probably damaging 1.00
R0463:Arhgap28 UTSW 17 67896225 missense probably damaging 1.00
R0626:Arhgap28 UTSW 17 67896113 unclassified probably null
R0691:Arhgap28 UTSW 17 67896164 unclassified probably null
R0811:Arhgap28 UTSW 17 67901299 small deletion probably benign
R1150:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1151:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1152:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1426:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1427:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1632:Arhgap28 UTSW 17 67849074 missense probably damaging 0.99
R1747:Arhgap28 UTSW 17 67901309 missense probably benign 0.02
R1951:Arhgap28 UTSW 17 67901341 missense probably benign 0.00
R2031:Arhgap28 UTSW 17 67896116 missense probably damaging 1.00
R2126:Arhgap28 UTSW 17 67869015 missense possibly damaging 0.90
R2181:Arhgap28 UTSW 17 67896117 missense probably damaging 1.00
R3700:Arhgap28 UTSW 17 67901366 missense probably damaging 1.00
R3800:Arhgap28 UTSW 17 67873036 missense probably damaging 1.00
R3811:Arhgap28 UTSW 17 67896093 missense probably benign
R4213:Arhgap28 UTSW 17 67871993 missense probably benign 0.04
R4347:Arhgap28 UTSW 17 67873142 missense probably benign
R4954:Arhgap28 UTSW 17 67869013 nonsense probably null
R5592:Arhgap28 UTSW 17 67858272 missense probably damaging 0.99
R5610:Arhgap28 UTSW 17 67896240 nonsense probably null
R5758:Arhgap28 UTSW 17 67873159 missense probably benign 0.04
R6413:Arhgap28 UTSW 17 67875588 missense probably benign 0.00
R6661:Arhgap28 UTSW 17 67845751 missense probably damaging 1.00
R6928:Arhgap28 UTSW 17 67901299 small deletion probably benign
Z1088:Arhgap28 UTSW 17 67861277 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CAGCTATTTGCAATCCTAGTTCACG -3'
(R):5'- TGTCAGCATCTACCAGAGGG -3'

Sequencing Primer
(F):5'- ACGTTTCCTTAGTCCATCTTGAAG -3'
(R):5'- TCACGGTGGCATGGCATG -3'
Posted On2016-11-21