Incidental Mutation 'R5742:Masp1'
ID445636
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Namemannan-binding lectin serine peptidase 1
SynonymsCrarf
MMRRC Submission 043352-MU
Accession Numbers

Genbank: NM_008555; MGI: 88492

Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5742 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location23449417-23520815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23454925 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 588 (M588L)
Ref Sequence ENSEMBL: ENSMUSP00000087327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883]
Predicted Effect probably benign
Transcript: ENSMUST00000089883
AA Change: M588L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: M588L

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,165,553 A794T possibly damaging Het
Abca9 T G 11: 110,160,417 E151A probably damaging Het
Abcb5 A G 12: 118,918,257 V579A probably damaging Het
Apob T A 12: 8,007,191 L1858Q probably damaging Het
Cerk C T 15: 86,141,572 E223K probably damaging Het
Cntnap2 T A 6: 45,920,926 Y179* probably null Het
Ddx60 A T 8: 61,948,921 Y277F probably benign Het
Dlgap1 T G 17: 70,718,199 V538G probably benign Het
Duox2 A G 2: 122,284,921 I1050T probably benign Het
Dusp10 A G 1: 184,037,656 probably null Het
Dusp27 A T 1: 166,099,454 V863E probably benign Het
Dync2h1 T A 9: 7,165,762 I500F possibly damaging Het
Erich3 T A 3: 154,733,323 C398S probably damaging Het
Fam213a T C 14: 41,002,503 E57G possibly damaging Het
Fez1 G A 9: 36,850,447 probably null Het
Fkbp3 A C 12: 65,070,038 H41Q probably benign Het
Fras1 C G 5: 96,768,381 Q3425E possibly damaging Het
Fuca1 T C 4: 135,922,975 V119A probably damaging Het
Grhl2 A G 15: 37,328,372 K414R probably damaging Het
Heatr5a A T 12: 51,955,552 C200* probably null Het
Hmgcs2 A G 3: 98,297,516 N330S probably benign Het
Hspd1 A G 1: 55,084,607 V118A probably benign Het
Jmjd1c A G 10: 67,220,333 T511A probably benign Het
Kat6b T C 14: 21,668,435 S1061P probably damaging Het
Kcnh6 T C 11: 106,009,142 V79A probably benign Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Klc4 C T 17: 46,642,271 R111Q probably damaging Het
Lrp1 T C 10: 127,548,347 D3641G probably damaging Het
Map2k1 A T 9: 64,193,771 D208E probably damaging Het
Mgl2 T A 11: 70,136,684 N239K probably benign Het
Mki67 G A 7: 135,704,373 T625M probably benign Het
Ndufb5 T C 3: 32,747,781 Y112H probably damaging Het
Npr3 A G 15: 11,883,408 S312P probably damaging Het
Nuf2 A T 1: 169,516,622 I125N probably damaging Het
Obox1 G A 7: 15,555,505 G73D possibly damaging Het
Olfr27 T A 9: 39,144,678 F193I probably benign Het
Olfr644 G T 7: 104,068,205 H275Q probably damaging Het
Pcdhb15 T C 18: 37,474,767 S351P probably damaging Het
Phc2 G T 4: 128,745,868 R121L probably damaging Het
Pla2g2a A G 4: 138,833,342 K87E probably benign Het
Plekhh2 T A 17: 84,597,980 S1101T probably damaging Het
Ppp4r1 T C 17: 65,837,746 I786T probably damaging Het
Ros1 A T 10: 52,142,138 probably null Het
Trnt1 T A 6: 106,778,917 L311* probably null Het
Ttc25 G A 11: 100,545,873 G25R possibly damaging Het
Vmn1r47 T A 6: 90,022,518 L211M probably damaging Het
Zfp12 A G 5: 143,245,190 E424G probably damaging Het
Zranb2 T A 3: 157,540,703 Y17* probably null Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23458091 missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23476312 missense probably damaging 1.00
IGL00432:Masp1 APN 16 23513851 missense probably damaging 1.00
IGL02598:Masp1 APN 16 23459631 missense probably benign
IGL02718:Masp1 APN 16 23476293 missense probably damaging 1.00
IGL02947:Masp1 APN 16 23494726 missense probably damaging 0.99
A4554:Masp1 UTSW 16 23454940 splice site probably null
PIT1430001:Masp1 UTSW 16 23513944 missense probably damaging 1.00
R0103:Masp1 UTSW 16 23458018 missense probably damaging 1.00
R0505:Masp1 UTSW 16 23458138 missense probably benign
R0630:Masp1 UTSW 16 23452419 missense probably benign 0.01
R1146:Masp1 UTSW 16 23492115 missense probably damaging 1.00
R1146:Masp1 UTSW 16 23492115 missense probably damaging 1.00
R1339:Masp1 UTSW 16 23452467 missense probably damaging 1.00
R1521:Masp1 UTSW 16 23494637 missense probably damaging 1.00
R1588:Masp1 UTSW 16 23494654 missense probably damaging 1.00
R1961:Masp1 UTSW 16 23452932 missense probably damaging 1.00
R1986:Masp1 UTSW 16 23483461 missense probably benign 0.01
R2080:Masp1 UTSW 16 23491959 missense probably damaging 1.00
R2215:Masp1 UTSW 16 23452521 missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23492055 missense probably benign 0.00
R2443:Masp1 UTSW 16 23476312 missense probably damaging 1.00
R4934:Masp1 UTSW 16 23465076 missense probably damaging 0.98
R5224:Masp1 UTSW 16 23494695 missense probably damaging 1.00
R5340:Masp1 UTSW 16 23458108 missense probably damaging 1.00
R5562:Masp1 UTSW 16 23465167 unclassified probably null
R5663:Masp1 UTSW 16 23452938 missense possibly damaging 0.57
R5763:Masp1 UTSW 16 23496247 missense probably damaging 1.00
R5898:Masp1 UTSW 16 23491927 missense probably damaging 0.99
R6901:Masp1 UTSW 16 23513834 missense probably damaging 0.99
R6987:Masp1 UTSW 16 23513915 missense probably damaging 1.00
R7069:Masp1 UTSW 16 23452455 missense probably benign 0.20
R7356:Masp1 UTSW 16 23470243 missense possibly damaging 0.50
X0065:Masp1 UTSW 16 23513969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAGTTGAGTTTGGCCCC -3'
(R):5'- TTGAGGTAGATCAACCAAGAAACC -3'

Sequencing Primer
(F):5'- GTTGAGTTTGGCCCCCATCTTTTATC -3'
(R):5'- CAGGTAACCCATCACAGAAGCAATG -3'
Posted On2016-11-21