Incidental Mutation 'R5744:Nol8'
ID445731
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Namenucleolar protein 8
Synonyms5730412B09Rik, D13Ertd548e, 4921532D18Rik
MMRRC Submission 043197-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5744 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49653078-49679016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49662326 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 619 (N619D)
Ref Sequence ENSEMBL: ENSMUSP00000152878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223467]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021824
AA Change: N637D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: N637D

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221083
Predicted Effect possibly damaging
Transcript: ENSMUST00000221142
AA Change: N619D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222197
AA Change: N637D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223346
Predicted Effect possibly damaging
Transcript: ENSMUST00000223467
AA Change: N619D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,346 I19V possibly damaging Het
Ascc3 T C 10: 50,710,881 I943T probably benign Het
Btaf1 T C 19: 37,004,490 V1640A probably benign Het
Cep250 T C 2: 155,981,474 F1015S possibly damaging Het
Cgnl1 G T 9: 71,630,675 probably null Het
Csgalnact2 C T 6: 118,126,236 G255E probably damaging Het
Ctla2a C T 13: 60,935,953 probably null Het
Dip2c A T 13: 9,568,405 I497F probably damaging Het
Eif3f C A 7: 108,938,417 T179K probably damaging Het
Frem2 A G 3: 53,655,959 F376L probably damaging Het
Gemin4 A T 11: 76,212,165 F590Y probably damaging Het
Gemin5 C A 11: 58,155,183 C433F possibly damaging Het
Gm7694 C T 1: 170,302,506 probably null Het
Gpr158 G A 2: 21,368,520 G89R probably damaging Het
Herc1 C T 9: 66,508,193 P4817S probably damaging Het
Hs6st3 T C 14: 119,138,440 L9P possibly damaging Het
Igdcc3 TGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGC 9: 65,141,488 probably benign Het
Il1rap A C 16: 26,680,224 I158L probably benign Het
Itpr2 A G 6: 146,376,151 S640P probably damaging Het
Metrn A G 17: 25,795,237 V205A probably damaging Het
Mfhas1 C A 8: 35,589,482 D370E probably damaging Het
Mn1 T C 5: 111,420,536 S791P possibly damaging Het
Mtmr3 A G 11: 4,487,679 V925A possibly damaging Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Nup214 T C 2: 32,010,296 L879P probably damaging Het
Olfr1353 T C 10: 78,970,183 F178S probably damaging Het
Olfr167 A G 16: 19,515,336 I100T probably benign Het
Olfr825 T C 10: 130,162,792 D178G possibly damaging Het
Plxna1 C T 6: 89,334,682 R947Q possibly damaging Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Reln A C 5: 22,106,083 S277R probably null Het
Sel1l A T 12: 91,809,980 I746N possibly damaging Het
Slc2a8 C T 2: 32,976,028 D291N probably benign Het
Slc7a5 T C 8: 121,888,382 N242S probably benign Het
Smco3 T C 6: 136,831,765 N37S probably damaging Het
Sult1c1 T A 17: 53,973,962 K38* probably null Het
Tfap2b T C 1: 19,219,221 M190T probably benign Het
Tnpo2 T A 8: 85,051,894 Y623* probably null Het
Tomm70a G T 16: 57,121,839 probably benign Het
Ttyh2 T C 11: 114,702,310 probably null Het
Zbtb10 A G 3: 9,264,563 Y327C probably damaging Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49662228 missense probably benign 0.01
IGL01106:Nol8 APN 13 49654481 missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49659952 missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49661670 missense probably benign 0.06
IGL01670:Nol8 APN 13 49661308 missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49675407 missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49672772 missense probably benign
IGL02212:Nol8 APN 13 49662150 missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49655245 splice site probably benign
IGL02645:Nol8 APN 13 49665471 critical splice donor site probably null
IGL02949:Nol8 APN 13 49662402 missense probably benign 0.01
IGL02954:Nol8 APN 13 49661172 missense probably benign 0.01
IGL03182:Nol8 APN 13 49664081 missense probably damaging 1.00
IGL03406:Nol8 APN 13 49661568 missense probably damaging 1.00
P0047:Nol8 UTSW 13 49654348 splice site probably null
R0092:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0099:Nol8 UTSW 13 49672689 missense probably benign
R0145:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49662152 missense probably damaging 1.00
R0617:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49676758 missense probably benign 0.05
R0637:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R1246:Nol8 UTSW 13 49676769 missense probably damaging 1.00
R1446:Nol8 UTSW 13 49655227 missense probably damaging 1.00
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1627:Nol8 UTSW 13 49661504 missense probably benign 0.01
R1703:Nol8 UTSW 13 49667457 missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49667408 missense probably benign 0.06
R2187:Nol8 UTSW 13 49661999 missense probably benign 0.00
R2357:Nol8 UTSW 13 49654504 critical splice donor site probably null
R3081:Nol8 UTSW 13 49678392 unclassified probably benign
R3969:Nol8 UTSW 13 49660016 nonsense probably null
R4199:Nol8 UTSW 13 49661748 missense possibly damaging 0.65
R4720:Nol8 UTSW 13 49662753 missense probably damaging 1.00
R4927:Nol8 UTSW 13 49654425 missense possibly damaging 0.79
R5177:Nol8 UTSW 13 49661112 missense probably benign 0.32
R5512:Nol8 UTSW 13 49676787 missense probably benign
R5988:Nol8 UTSW 13 49672614 missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49653684 critical splice donor site probably null
R6306:Nol8 UTSW 13 49676353 missense probably damaging 1.00
R6359:Nol8 UTSW 13 49664070 missense probably benign 0.16
R6378:Nol8 UTSW 13 49667355 missense probably damaging 1.00
R6655:Nol8 UTSW 13 49654392 missense probably damaging 1.00
R7035:Nol8 UTSW 13 49661202 missense probably benign 0.06
R7058:Nol8 UTSW 13 49676386 missense probably damaging 1.00
R7368:Nol8 UTSW 13 49661219 missense probably benign 0.00
R7450:Nol8 UTSW 13 49660015 missense probably benign 0.01
X0020:Nol8 UTSW 13 49661165 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAAATTCCAGGCCTTCAAGG -3'
(R):5'- AGCGTCTCCATCAGAGTCTAC -3'

Sequencing Primer
(F):5'- CCTTCAAGGGAATAGGCTGTCTC -3'
(R):5'- CTACCTTGTGACTGTTGGCACTAAG -3'
Posted On2016-11-21