Incidental Mutation 'R5746:Kel'
ID445782
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 043199-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5746 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41699027 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 243 (G243E)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899]
Predicted Effect probably damaging
Transcript: ENSMUST00000031899
AA Change: G243E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: G243E

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000192118
AA Change: G18E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192406
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 A G 3: 105,907,810 E292G possibly damaging Het
Ank1 C T 8: 23,116,596 T1187I probably damaging Het
Ankrd16 T A 2: 11,784,367 I255K probably damaging Het
Atp6ap1l T C 13: 90,883,579 N328S probably benign Het
Cbln3 A G 14: 55,883,144 S144P probably damaging Het
Cdh12 T A 15: 21,358,724 L78Q probably null Het
Cpsf1 C T 15: 76,599,837 R761H probably benign Het
Cyp2d10 T G 15: 82,405,271 E213D probably benign Het
Gba2 T C 4: 43,568,465 probably null Het
Glb1l2 G A 9: 26,796,790 A29V probably benign Het
Gm11149 C T 9: 49,546,194 G393S probably damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Kcnma1 T C 14: 23,494,567 N574S probably damaging Het
Kdm2b A G 5: 122,879,364 V1099A probably damaging Het
Ly6g A T 15: 75,156,747 N19Y possibly damaging Het
Nexn TCTTCCTTC TCTTC 3: 152,242,876 probably benign Het
Nod2 T C 8: 88,664,342 S411P probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpn14 G A 1: 189,846,413 probably null Het
Smg6 G A 11: 75,139,287 G211E probably damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d15 T C 10: 115,210,279 S440G probably damaging Het
Tpm2 A G 4: 43,519,731 V85A possibly damaging Het
Ttf1 G T 2: 29,065,742 A373S probably damaging Het
Vmn2r11 T A 5: 109,053,694 T315S probably benign Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Zfp146 T C 7: 30,162,393 S75G probably benign Het
Zfp994 A G 17: 22,201,273 Y232H probably damaging Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 unclassified probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGAGACCATCAAGCACAG -3'
(R):5'- TCTCTTGTGTCCAGATAGACCAG -3'

Sequencing Primer
(F):5'- GAGTCCCCAGACCCTCAG -3'
(R):5'- TAGACCAGCCGGAGTTTGACATTC -3'
Posted On2016-11-21