Incidental Mutation 'R5747:Slc27a2'
ID445809
Institutional Source Beutler Lab
Gene Symbol Slc27a2
Ensembl Gene ENSMUSG00000027359
Gene Namesolute carrier family 27 (fatty acid transporter), member 2
SynonymsVLCS, ACSVL1, Vlac, FATP2, FATP2, Vlacs
MMRRC Submission 043354-MU
Accession Numbers

Genbank: NM_011978.2 ; Ensembl: ENSMUST00000061491, ENSMUST00000141482, ENSMUST00000126249, ENSMUST00000150947

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126552407-126588243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126564738 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 114 (M114K)
Ref Sequence ENSEMBL: ENSMUSP00000117145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061491] [ENSMUST00000141482]
Predicted Effect probably benign
Transcript: ENSMUST00000061491
AA Change: M250K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057595
Gene: ENSMUSG00000027359
AA Change: M250K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 41 53 N/A INTRINSIC
Pfam:AMP-binding 59 488 1.4e-71 PFAM
Pfam:AMP-binding_C 496 572 1.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126249
Predicted Effect probably benign
Transcript: ENSMUST00000141482
AA Change: M114K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117145
Gene: ENSMUSG00000027359
AA Change: M114K

DomainStartEndE-ValueType
Pfam:AMP-binding 7 256 6.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150947
Meta Mutation Damage Score 0.0408 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme activates long-chain, branched-chain and very-long-chain fatty acids containing 22 or more carbons to their CoA derivatives. It is expressed primarily in liver and kidney, and is present in both endoplasmic reticulum and peroxisomes, but not in mitochondria. Its decreased peroxisomal enzyme activity is in part responsible for the biochemical pathology in X-linked adrenoleukodystrophy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphological abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Slc27a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc27a2 APN 2 126580917 missense probably damaging 1.00
IGL01907:Slc27a2 APN 2 126587874 missense probably benign 0.02
IGL02185:Slc27a2 APN 2 126567816 missense probably damaging 0.99
IGL02363:Slc27a2 APN 2 126578950 missense possibly damaging 0.58
IGL02451:Slc27a2 APN 2 126578992 missense probably benign 0.00
IGL02486:Slc27a2 APN 2 126553350 missense probably benign 0.00
IGL03217:Slc27a2 APN 2 126586252 missense possibly damaging 0.80
IGL03287:Slc27a2 APN 2 126553392 missense probably damaging 1.00
IGL03291:Slc27a2 APN 2 126564750 missense probably benign 0.14
baseboard UTSW 2 126567780 missense probably damaging 0.97
B6584:Slc27a2 UTSW 2 126561642 missense possibly damaging 0.94
R0021:Slc27a2 UTSW 2 126567886 splice site probably benign
R0647:Slc27a2 UTSW 2 126587916 missense probably benign 0.00
R1326:Slc27a2 UTSW 2 126564770 missense probably damaging 1.00
R1509:Slc27a2 UTSW 2 126553314 missense possibly damaging 0.95
R1907:Slc27a2 UTSW 2 126586342 missense probably benign 0.13
R2012:Slc27a2 UTSW 2 126553615 missense probably damaging 0.98
R2217:Slc27a2 UTSW 2 126567752 missense probably damaging 0.99
R3769:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R3770:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R5244:Slc27a2 UTSW 2 126578855 missense probably benign 0.00
R5459:Slc27a2 UTSW 2 126580992 missense probably damaging 0.98
R5582:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5606:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5655:Slc27a2 UTSW 2 126578939 missense probably damaging 1.00
R5680:Slc27a2 UTSW 2 126561610 missense probably benign 0.02
R6346:Slc27a2 UTSW 2 126587880 missense probably damaging 0.97
R7042:Slc27a2 UTSW 2 126567780 missense probably damaging 0.97
R7297:Slc27a2 UTSW 2 126578946 missense probably damaging 0.99
R7323:Slc27a2 UTSW 2 126553204 missense probably benign 0.38
R7391:Slc27a2 UTSW 2 126553162 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCTGCATTGGTGTGAGAG -3'
(R):5'- ACCCCTAAGGCTTTGGAGTC -3'

Sequencing Primer
(F):5'- GAGAGAATTTTGTACACCAGCTCTCC -3'
(R):5'- CCCTAAGGCTTTGGAGTCAATGC -3'
Posted On2016-11-21