Incidental Mutation 'R5747:Ankrd34c'
ID445824
Institutional Source Beutler Lab
Gene Symbol Ankrd34c
Ensembl Gene ENSMUSG00000047606
Gene Nameankyrin repeat domain 34C
SynonymsLOC330998, B230218L05Rik
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location89725245-89738475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89729761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 176 (V176M)
Ref Sequence ENSEMBL: ENSMUSP00000140919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060700] [ENSMUST00000185470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060700
AA Change: V176M

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056787
Gene: ENSMUSG00000047606
AA Change: V176M

DomainStartEndE-ValueType
ANK 10 39 1.16e3 SMART
ANK 43 80 1.46e-2 SMART
ANK 84 114 1.52e0 SMART
ANK 118 147 1.33e2 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185470
AA Change: V176M

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140919
Gene: ENSMUSG00000047606
AA Change: V176M

DomainStartEndE-ValueType
ANK 10 39 1.16e3 SMART
ANK 43 80 1.46e-2 SMART
ANK 84 114 1.52e0 SMART
ANK 118 147 1.33e2 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Ankrd34c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Ankrd34c APN 9 89729026 missense probably benign 0.15
IGL01630:Ankrd34c APN 9 89729826 missense probably damaging 0.99
IGL01683:Ankrd34c APN 9 89729797 missense probably benign 0.09
IGL01886:Ankrd34c APN 9 89730265 missense possibly damaging 0.71
IGL02323:Ankrd34c APN 9 89729980 missense possibly damaging 0.80
IGL02679:Ankrd34c APN 9 89730079 missense probably damaging 1.00
IGL03000:Ankrd34c APN 9 89729186 missense probably benign 0.00
IGL03008:Ankrd34c APN 9 89730284 start codon destroyed probably null 0.05
R0024:Ankrd34c UTSW 9 89729527 missense possibly damaging 0.93
R0107:Ankrd34c UTSW 9 89729484 missense probably benign
R1602:Ankrd34c UTSW 9 89729005 missense possibly damaging 0.66
R1879:Ankrd34c UTSW 9 89730073 missense probably damaging 1.00
R4114:Ankrd34c UTSW 9 89729874 missense probably damaging 1.00
R4115:Ankrd34c UTSW 9 89729874 missense probably damaging 1.00
R4116:Ankrd34c UTSW 9 89729874 missense probably damaging 1.00
R4291:Ankrd34c UTSW 9 89729764 nonsense probably null
R5012:Ankrd34c UTSW 9 89729656 missense probably benign 0.00
R5020:Ankrd34c UTSW 9 89729706 missense probably benign 0.16
R6766:Ankrd34c UTSW 9 89729328 missense probably benign
R7011:Ankrd34c UTSW 9 89728948 nonsense probably null
X0022:Ankrd34c UTSW 9 89729826 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTTCCTGGTGGGTGATCC -3'
(R):5'- TCCTTACTGCTGGAAAATGGAG -3'

Sequencing Primer
(F):5'- GATCCAGGCTCATTAAGGACCTTAG -3'
(R):5'- CCAGTCTTGAGGATCGAACTG -3'
Posted On2016-11-21