Incidental Mutation 'R5747:Kcnh5'
ID445832
Institutional Source Beutler Lab
Gene Symbol Kcnh5
Ensembl Gene ENSMUSG00000034402
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 5
Synonyms
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location74897220-75177332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74898420 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 685 (E685G)
Ref Sequence ENSEMBL: ENSMUSP00000046864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042299]
Predicted Effect probably benign
Transcript: ENSMUST00000042299
AA Change: E685G

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046864
Gene: ENSMUSG00000034402
AA Change: E685G

DomainStartEndE-ValueType
PAS 14 86 8.97e0 SMART
PAC 92 134 6.64e-7 SMART
Pfam:Ion_trans 214 479 1.2e-37 PFAM
Pfam:Ion_trans_2 390 473 5e-14 PFAM
cNMP 550 668 2.48e-15 SMART
low complexity region 710 717 N/A INTRINSIC
coiled coil region 907 944 N/A INTRINSIC
low complexity region 953 968 N/A INTRINSIC
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted gene disruption display thigmotaxis and abnormal startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Kcnh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kcnh5 APN 12 74897796 missense probably benign 0.00
IGL00675:Kcnh5 APN 12 75114189 critical splice donor site probably null
IGL00688:Kcnh5 APN 12 74898397 missense probably benign 0.01
IGL00721:Kcnh5 APN 12 75007676 missense probably benign 0.32
IGL00793:Kcnh5 APN 12 75114346 missense probably damaging 0.99
IGL00802:Kcnh5 APN 12 75007625 missense possibly damaging 0.62
IGL00920:Kcnh5 APN 12 74976493 missense probably damaging 1.00
IGL01595:Kcnh5 APN 12 74898327 missense probably benign 0.05
IGL01642:Kcnh5 APN 12 74965169 missense probably damaging 0.98
IGL01675:Kcnh5 APN 12 75114500 nonsense probably null
IGL01733:Kcnh5 APN 12 74965192 missense probably benign 0.02
IGL02006:Kcnh5 APN 12 74897548 missense probably damaging 0.99
IGL02075:Kcnh5 APN 12 75087605 missense probably benign 0.00
IGL02148:Kcnh5 APN 12 74897652 missense possibly damaging 0.86
IGL02155:Kcnh5 APN 12 75176538 utr 5 prime probably benign
IGL02304:Kcnh5 APN 12 74976697 missense probably benign 0.01
IGL02957:Kcnh5 APN 12 75007665 missense probably benign 0.01
R0305:Kcnh5 UTSW 12 75114397 missense probably benign 0.00
R0470:Kcnh5 UTSW 12 75114414 missense probably benign 0.22
R0553:Kcnh5 UTSW 12 75137673 missense probably benign 0.00
R0557:Kcnh5 UTSW 12 75114549 missense probably damaging 1.00
R0590:Kcnh5 UTSW 12 74965261 missense probably damaging 1.00
R0697:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R0699:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R1512:Kcnh5 UTSW 12 75119937 missense probably benign
R1728:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1739:Kcnh5 UTSW 12 75114229 missense probably damaging 1.00
R1784:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1956:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R1957:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R2155:Kcnh5 UTSW 12 74898456 critical splice acceptor site probably null
R2185:Kcnh5 UTSW 12 75130931 missense possibly damaging 0.95
R2237:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2239:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2483:Kcnh5 UTSW 12 75114471 missense probably damaging 1.00
R2655:Kcnh5 UTSW 12 75114540 missense probably damaging 1.00
R3767:Kcnh5 UTSW 12 75087576 missense possibly damaging 0.81
R3835:Kcnh5 UTSW 12 74898270 missense probably benign
R4681:Kcnh5 UTSW 12 75007623 missense probably benign 0.00
R4728:Kcnh5 UTSW 12 75007781 missense probably damaging 1.00
R4965:Kcnh5 UTSW 12 74965151 missense probably benign 0.11
R5127:Kcnh5 UTSW 12 74898084 missense probably benign 0.17
R5267:Kcnh5 UTSW 12 75087416 missense probably damaging 0.98
R5535:Kcnh5 UTSW 12 75130907 missense possibly damaging 0.76
R5590:Kcnh5 UTSW 12 74976689 missense probably benign 0.05
R5684:Kcnh5 UTSW 12 75137649 missense probably damaging 1.00
R6123:Kcnh5 UTSW 12 75087591 missense probably benign 0.01
R6545:Kcnh5 UTSW 12 75007658 missense probably damaging 1.00
R6662:Kcnh5 UTSW 12 75007611 missense probably damaging 1.00
R7117:Kcnh5 UTSW 12 75114445 missense possibly damaging 0.87
R7161:Kcnh5 UTSW 12 74897709 missense probably benign 0.10
R7437:Kcnh5 UTSW 12 75137643 critical splice donor site probably null
R7557:Kcnh5 UTSW 12 75007625 missense possibly damaging 0.62
R7566:Kcnh5 UTSW 12 75114392 nonsense probably null
Z1088:Kcnh5 UTSW 12 74897761 missense probably benign 0.00
Z1088:Kcnh5 UTSW 12 74965295 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACACTGGTACCTGTGATGGAG -3'
(R):5'- TGTAGTCAGTCAGTGTCCCTG -3'

Sequencing Primer
(F):5'- AGGCTCCGTTCTGCAAAG -3'
(R):5'- GGTATATTGAATTGTTACGTGGCAAC -3'
Posted On2016-11-21