Incidental Mutation 'R5747:Itgbl1'
ID445838
Institutional Source Beutler Lab
Gene Symbol Itgbl1
Ensembl Gene ENSMUSG00000032925
Gene Nameintegrin, beta-like 1
SynonymsB930011D01Rik, with EGF-like repeat domains
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location123659971-123975618 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 123972164 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 318 (Y318*)
Ref Sequence ENSEMBL: ENSMUSP00000115455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049681] [ENSMUST00000132026] [ENSMUST00000142161]
Predicted Effect probably null
Transcript: ENSMUST00000049681
AA Change: Y442*
SMART Domains Protein: ENSMUSP00000059019
Gene: ENSMUSG00000032925
AA Change: Y442*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
internal_repeat_1 62 164 7.9e-12 PROSPERO
EGF_like 184 217 6.95e1 SMART
EGF 275 311 2.25e1 SMART
low complexity region 335 348 N/A INTRINSIC
Pfam:EGF_2 368 398 3.6e-8 PFAM
low complexity region 423 438 N/A INTRINSIC
low complexity region 448 456 N/A INTRINSIC
Blast:EGF_like 457 486 4e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000132026
AA Change: Y318*
SMART Domains Protein: ENSMUSP00000115455
Gene: ENSMUSG00000032925
AA Change: Y318*

DomainStartEndE-ValueType
internal_repeat_2 22 50 3.54e-8 PROSPERO
internal_repeat_1 23 87 7.45e-14 PROSPERO
low complexity region 101 126 N/A INTRINSIC
EGF 151 187 2.25e1 SMART
low complexity region 211 224 N/A INTRINSIC
Pfam:EGF_2 239 274 1.5e-7 PFAM
low complexity region 299 314 N/A INTRINSIC
low complexity region 324 332 N/A INTRINSIC
internal_repeat_2 334 362 3.54e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000142161
SMART Domains Protein: ENSMUSP00000121659
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G1E|B 59 171 1e-17 PDB
Blast:EGF_like 90 127 5e-15 BLAST
low complexity region 178 192 N/A INTRINSIC
Meta Mutation Damage Score 0.658 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta integrin-related protein that is a member of the EGF-like protein family. The encoded protein contains integrin-like cysteine-rich repeats. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Itgbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Itgbl1 APN 14 123846432 splice site probably benign
IGL01290:Itgbl1 APN 14 123966725 missense probably benign 0.02
IGL01618:Itgbl1 APN 14 123827799 missense possibly damaging 0.88
IGL02024:Itgbl1 APN 14 123857492 missense probably damaging 1.00
IGL02192:Itgbl1 APN 14 123843926 missense probably damaging 1.00
IGL02215:Itgbl1 APN 14 123972141 missense probably benign 0.01
IGL02400:Itgbl1 APN 14 123846526 missense probably damaging 1.00
IGL02483:Itgbl1 APN 14 123827743 splice site probably benign
H8441:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
R0137:Itgbl1 UTSW 14 123840686 critical splice donor site probably null
R0193:Itgbl1 UTSW 14 123846546 missense probably benign 0.09
R0355:Itgbl1 UTSW 14 123840585 nonsense probably null
R0598:Itgbl1 UTSW 14 123857436 missense possibly damaging 0.93
R0662:Itgbl1 UTSW 14 123827894 missense probably damaging 1.00
R0689:Itgbl1 UTSW 14 123827847 missense possibly damaging 0.65
R1385:Itgbl1 UTSW 14 123661511 splice site probably null
R1957:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3739:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3842:Itgbl1 UTSW 14 123840565 missense possibly damaging 0.92
R4434:Itgbl1 UTSW 14 123972199 missense probably damaging 1.00
R4463:Itgbl1 UTSW 14 123840668 missense probably damaging 0.97
R4696:Itgbl1 UTSW 14 123966708 missense probably damaging 1.00
R4937:Itgbl1 UTSW 14 123973368 missense probably benign 0.12
R5087:Itgbl1 UTSW 14 123966739 missense possibly damaging 0.52
R6020:Itgbl1 UTSW 14 123846565 missense probably damaging 0.99
R6169:Itgbl1 UTSW 14 123660378 missense probably benign 0.17
R6758:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
R7213:Itgbl1 UTSW 14 123973297 missense probably damaging 1.00
R7259:Itgbl1 UTSW 14 123843904 missense probably damaging 0.96
V1024:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
X0012:Itgbl1 UTSW 14 123661305 missense probably benign 0.01
X0017:Itgbl1 UTSW 14 123972211 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGTATTACAGTAAGTAAAGCTCCCCTC -3'
(R):5'- TCATTTGAGTGCATGGACGC -3'

Sequencing Primer
(F):5'- GTAAGTAAAGCTCCCCTCTGAGAAG -3'
(R):5'- ATGGACGCTGCCCTCTCTG -3'
Posted On2016-11-21