Incidental Mutation 'R5747:Arhgap39'
ID445840
Institutional Source Beutler Lab
Gene Symbol Arhgap39
Ensembl Gene ENSMUSG00000033697
Gene NameRho GTPase activating protein 39
SynonymsD15Wsu169e
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76723985-76818170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76741535 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 190 (D190N)
Ref Sequence ENSEMBL: ENSMUSP00000036697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000077821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036176
AA Change: D190N

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697
AA Change: D190N

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 759 904 2.3e-32 PFAM
RhoGAP 932 1105 5.9e-28 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077821
AA Change: D190N

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697
AA Change: D190N

DomainStartEndE-ValueType
WW 27 60 1.64e0 SMART
WW 66 99 5.41e-1 SMART
low complexity region 125 138 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
Pfam:MyTH4 756 874 3.3e-25 PFAM
RhoGAP 901 1074 5.9e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177011
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Arhgap39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Arhgap39 APN 15 76737815 splice site probably benign
IGL01586:Arhgap39 APN 15 76730438 missense probably benign 0.16
IGL01693:Arhgap39 APN 15 76725967 missense probably null 1.00
IGL02017:Arhgap39 APN 15 76737037 missense probably damaging 0.98
IGL02508:Arhgap39 APN 15 76724984 makesense probably null
IGL03333:Arhgap39 APN 15 76726732 missense probably benign 0.05
R0328:Arhgap39 UTSW 15 76751952 splice site probably benign
R0432:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0479:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0549:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R0551:Arhgap39 UTSW 15 76734886 missense probably damaging 0.99
R1054:Arhgap39 UTSW 15 76751559 missense probably benign
R1830:Arhgap39 UTSW 15 76735183 missense probably damaging 1.00
R2421:Arhgap39 UTSW 15 76725146 missense probably damaging 1.00
R2497:Arhgap39 UTSW 15 76725385 missense probably damaging 1.00
R3909:Arhgap39 UTSW 15 76751888 missense probably benign 0.03
R4410:Arhgap39 UTSW 15 76725512 unclassified probably benign
R4626:Arhgap39 UTSW 15 76737637 missense possibly damaging 0.92
R4790:Arhgap39 UTSW 15 76726731 missense possibly damaging 0.51
R4792:Arhgap39 UTSW 15 76741517 missense possibly damaging 0.92
R4911:Arhgap39 UTSW 15 76737805 missense probably damaging 1.00
R5225:Arhgap39 UTSW 15 76725515 unclassified probably benign
R5417:Arhgap39 UTSW 15 76735101 missense possibly damaging 0.80
R5443:Arhgap39 UTSW 15 76797925 intron probably benign
R5521:Arhgap39 UTSW 15 76765494 missense possibly damaging 0.66
R5686:Arhgap39 UTSW 15 76726633 missense probably damaging 1.00
R5785:Arhgap39 UTSW 15 76737418 missense probably benign
R5879:Arhgap39 UTSW 15 76751807 missense probably damaging 1.00
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6035:Arhgap39 UTSW 15 76737224 nonsense probably null
R6049:Arhgap39 UTSW 15 76727401 critical splice donor site probably null
R6143:Arhgap39 UTSW 15 76730406 nonsense probably null
R6232:Arhgap39 UTSW 15 76736512 missense probably damaging 1.00
R6276:Arhgap39 UTSW 15 76737536 missense probably benign 0.06
R6277:Arhgap39 UTSW 15 76735137 missense probably damaging 1.00
R6305:Arhgap39 UTSW 15 76737702 missense probably benign 0.31
R6587:Arhgap39 UTSW 15 76737499 missense probably damaging 1.00
R7153:Arhgap39 UTSW 15 76765491 missense probably benign 0.09
R7447:Arhgap39 UTSW 15 76765597 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCTCCAGAAGCTGATAGG -3'
(R):5'- CATAAGAAGTGCAACCCAGGTC -3'

Sequencing Primer
(F):5'- TGATAGGAGCCACACGACTCTTC -3'
(R):5'- GTGCAACCCAGGTCATCCC -3'
Posted On2016-11-21