Incidental Mutation 'R5747:Akap8l'
ID445844
Institutional Source Beutler Lab
Gene Symbol Akap8l
Ensembl Gene ENSMUSG00000002625
Gene NameA kinase (PRKA) anchor protein 8-like
SynonymsNakap95
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32321425-32350581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32345378 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 12 (T12A)
Ref Sequence ENSEMBL: ENSMUSP00000051389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050214]
Predicted Effect probably damaging
Transcript: ENSMUST00000050214
AA Change: T12A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625
AA Change: T12A

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 307 324 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
coiled coil region 356 383 N/A INTRINSIC
ZnF_C2H2 389 413 1.05e1 SMART
SCOP:d1jvr__ 538 613 7e-5 SMART
low complexity region 628 640 N/A INTRINSIC
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Akap8l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Akap8l APN 17 32333097 missense possibly damaging 0.82
IGL01603:Akap8l APN 17 32345353 missense probably damaging 1.00
IGL02028:Akap8l APN 17 32338521 splice site probably null
IGL02033:Akap8l APN 17 32338272 missense probably damaging 1.00
IGL02301:Akap8l APN 17 32332926 splice site probably benign
R1136:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1137:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1192:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1277:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1279:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1703:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1705:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1706:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1727:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1763:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1774:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1796:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1954:Akap8l UTSW 17 32336736 missense possibly damaging 0.74
R2072:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2073:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2074:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2107:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2108:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2214:Akap8l UTSW 17 32338825 critical splice acceptor site probably null
R2215:Akap8l UTSW 17 32321595 missense possibly damaging 0.72
R2219:Akap8l UTSW 17 32334631 missense probably benign 0.23
R2234:Akap8l UTSW 17 32338803 missense probably damaging 1.00
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R4273:Akap8l UTSW 17 32321931 nonsense probably null
R4379:Akap8l UTSW 17 32321514 unclassified probably benign
R5061:Akap8l UTSW 17 32332894 missense probably damaging 1.00
R5337:Akap8l UTSW 17 32336394 missense possibly damaging 0.71
R5377:Akap8l UTSW 17 32321511 unclassified probably benign
R5579:Akap8l UTSW 17 32321942 missense probably damaging 1.00
R5609:Akap8l UTSW 17 32338400 missense probably damaging 1.00
R5667:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R5671:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R6186:Akap8l UTSW 17 32333044 missense probably benign 0.02
R6400:Akap8l UTSW 17 32336320 missense probably damaging 0.99
R6482:Akap8l UTSW 17 32345396 missense possibly damaging 0.94
R6712:Akap8l UTSW 17 32332888 missense probably damaging 1.00
V5088:Akap8l UTSW 17 32336739 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GATTGCCTCAAAGAAGCACAAG -3'
(R):5'- AGTTAAGCATGACCTGTCTGTAC -3'

Sequencing Primer
(F):5'- GCACAAGCTGGCCAAACAGG -3'
(R):5'- GCATGACCTGTCTGTACTGATTAATG -3'
Posted On2016-11-21