Incidental Mutation 'R5748:Lgr6'
ID445851
Institutional Source Beutler Lab
Gene Symbol Lgr6
Ensembl Gene ENSMUSG00000042793
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 6
SynonymsA530037C04Rik
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134983301-135105276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134994010 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 199 (A199T)
Ref Sequence ENSEMBL: ENSMUSP00000122334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044828] [ENSMUST00000137968]
Predicted Effect probably damaging
Transcript: ENSMUST00000044828
AA Change: A476T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: A476T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 34 70 5.19e-3 SMART
LRR 64 88 1.03e1 SMART
LRR_TYP 89 112 6.52e-5 SMART
LRR_TYP 113 136 2.71e-2 SMART
LRR_TYP 137 160 4.79e-3 SMART
LRR_TYP 161 184 1.58e-3 SMART
LRR_TYP 185 208 2.36e-2 SMART
LRR_TYP 209 232 3.39e-3 SMART
LRR 233 255 8.97e0 SMART
LRR_TYP 256 279 1.36e-2 SMART
Blast:LRR 281 303 6e-7 BLAST
LRR 327 350 9.24e1 SMART
LRR 351 373 1.41e0 SMART
LRR 374 396 4.84e1 SMART
LRR_TYP 397 420 4.54e-4 SMART
LRR_TYP 421 444 7.15e-2 SMART
transmembrane domain 568 590 N/A INTRINSIC
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 686 708 N/A INTRINSIC
transmembrane domain 728 750 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 808 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137968
AA Change: A199T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122334
Gene: ENSMUSG00000042793
AA Change: A199T

DomainStartEndE-ValueType
Blast:LRR 4 26 2e-7 BLAST
LRR 50 73 9.24e1 SMART
LRR 74 96 1.41e0 SMART
LRR 97 119 4.84e1 SMART
LRR_TYP 120 143 4.54e-4 SMART
LRR_TYP 144 167 7.15e-2 SMART
Pfam:7tm_1 301 550 3.6e-9 PFAM
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Lgr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Lgr6 APN 1 135001691 splice site probably benign
IGL02483:Lgr6 APN 1 135001691 splice site probably benign
IGL03270:Lgr6 APN 1 134997704 missense probably damaging 1.00
R0002:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0294:Lgr6 UTSW 1 134987891 missense probably damaging 0.99
R0294:Lgr6 UTSW 1 135105061 missense unknown
R0361:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0390:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0731:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0734:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0741:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0742:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0765:Lgr6 UTSW 1 134993886 missense probably benign 0.04
R0903:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0904:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0905:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0906:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0907:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0908:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0967:Lgr6 UTSW 1 134994012 missense probably damaging 1.00
R1078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1131:Lgr6 UTSW 1 134987304 missense probably damaging 0.98
R1440:Lgr6 UTSW 1 134987472 missense probably damaging 1.00
R1533:Lgr6 UTSW 1 135104932 missense possibly damaging 0.66
R1728:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1728:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1728:Lgr6 UTSW 1 135003476 missense probably benign
R1729:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1729:Lgr6 UTSW 1 134988009 missense probably benign
R1729:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1729:Lgr6 UTSW 1 135003476 missense probably benign
R1730:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1730:Lgr6 UTSW 1 134988009 missense probably benign
R1730:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1730:Lgr6 UTSW 1 135003476 missense probably benign
R1739:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1739:Lgr6 UTSW 1 134988009 missense probably benign
R1739:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1739:Lgr6 UTSW 1 135003476 missense probably benign
R1762:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1762:Lgr6 UTSW 1 134988009 missense probably benign
R1762:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1762:Lgr6 UTSW 1 135003476 missense probably benign
R1782:Lgr6 UTSW 1 134987979 missense probably damaging 0.98
R1783:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1783:Lgr6 UTSW 1 134988009 missense probably benign
R1783:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1783:Lgr6 UTSW 1 135003476 missense probably benign
R1784:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1784:Lgr6 UTSW 1 134988009 missense probably benign
R1784:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1784:Lgr6 UTSW 1 135003476 missense probably benign
R1785:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1785:Lgr6 UTSW 1 134988009 missense probably benign
R1785:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1785:Lgr6 UTSW 1 135003476 missense probably benign
R2020:Lgr6 UTSW 1 135075275 missense probably damaging 1.00
R3104:Lgr6 UTSW 1 135000472 splice site probably null
R4629:Lgr6 UTSW 1 135104932 missense probably damaging 0.99
R4792:Lgr6 UTSW 1 135021806 missense probably benign 0.03
R5001:Lgr6 UTSW 1 134990632 missense probably benign 0.01
R5191:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5194:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5195:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5196:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5197:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5228:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5230:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5243:Lgr6 UTSW 1 135109272 unclassified probably benign
R5299:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5300:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5417:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5419:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5601:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5603:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5636:Lgr6 UTSW 1 134987078 missense probably benign 0.28
R5699:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5767:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5825:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5971:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6138:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6258:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6259:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6260:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6740:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6871:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6984:Lgr6 UTSW 1 134988002 missense possibly damaging 0.54
R6986:Lgr6 UTSW 1 134993956 missense possibly damaging 0.80
R7233:Lgr6 UTSW 1 135000476 critical splice donor site probably null
Z1088:Lgr6 UTSW 1 134988071 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTTCCTTCGGGGTCACAAG -3'
(R):5'- AGGAATCAGGCTTCAAGATTCC -3'

Sequencing Primer
(F):5'- GTCACAAGGATCCCTACTAATACTTC -3'
(R):5'- TTATGGTTGCAAGTCACCACAGC -3'
Posted On2016-11-21