Incidental Mutation 'R5748:Tmx3'
ID445899
Institutional Source Beutler Lab
Gene Symbol Tmx3
Ensembl Gene ENSMUSG00000024614
Gene Namethioredoxin-related transmembrane protein 3
Synonyms6430411B10Rik, A730024F05Rik, Txndc10
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location90510154-90543267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90537101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 314 (V314A)
Ref Sequence ENSEMBL: ENSMUSP00000025515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025515]
Predicted Effect probably benign
Transcript: ENSMUST00000025515
AA Change: V314A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025515
Gene: ENSMUSG00000024614
AA Change: V314A

DomainStartEndE-ValueType
Pfam:Thioredoxin 30 132 3.6e-26 PFAM
Pfam:Thioredoxin_6 160 341 1.6e-27 PFAM
transmembrane domain 377 399 N/A INTRINSIC
low complexity region 418 436 N/A INTRINSIC
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and a C-terminal ER-retention sequence. This gene is expressed in many tissues but has its highest expression in heart and skeletal muscle. It is expressed in the retinal neuroepithelium and lens epithelium in the developing murine eye and haploinsufficiency of this gene in humans and zebrafish is associated with microphthalmia. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Tmx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Tmx3 APN 18 90540054 missense possibly damaging 0.53
IGL01790:Tmx3 APN 18 90511334 critical splice donor site probably null
IGL01888:Tmx3 APN 18 90527921 missense probably benign 0.05
IGL02689:Tmx3 APN 18 90537116 missense possibly damaging 0.70
IGL03212:Tmx3 APN 18 90538518 missense probably damaging 0.98
R0243:Tmx3 UTSW 18 90538489 splice site probably benign
R0255:Tmx3 UTSW 18 90540006 missense probably damaging 0.96
R0981:Tmx3 UTSW 18 90537200 missense probably benign
R1528:Tmx3 UTSW 18 90537086 missense possibly damaging 0.89
R1772:Tmx3 UTSW 18 90532997 missense probably benign
R2144:Tmx3 UTSW 18 90517490 missense probably damaging 1.00
R2155:Tmx3 UTSW 18 90510381 splice site probably null
R2202:Tmx3 UTSW 18 90527913 missense probably damaging 1.00
R2444:Tmx3 UTSW 18 90540183 missense probably damaging 1.00
R2960:Tmx3 UTSW 18 90532992 missense probably damaging 0.98
R3435:Tmx3 UTSW 18 90527904 missense probably damaging 1.00
R3946:Tmx3 UTSW 18 90524335 missense possibly damaging 0.78
R4427:Tmx3 UTSW 18 90523601 missense probably damaging 0.99
R4708:Tmx3 UTSW 18 90521039 critical splice donor site probably null
R5938:Tmx3 UTSW 18 90527934 missense possibly damaging 0.79
R6266:Tmx3 UTSW 18 90537210 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGTTCTTGTAGACCACAGTGG -3'
(R):5'- CAGTGGGATGAAGCTGATTCCC -3'

Sequencing Primer
(F):5'- GCTCCTAAGATATAAATGAGGA -3'
(R):5'- GGGATGAAGCTGATTCCCTCTAAC -3'
Posted On2016-11-21