Incidental Mutation 'R5749:Fbxo17'
ID445916
Institutional Source Beutler Lab
Gene Symbol Fbxo17
Ensembl Gene ENSMUSG00000030598
Gene NameF-box protein 17
SynonymsFbg4, Fbx17, FBXO26
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5749 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28716804-28738144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28737472 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 284 (R284H)
Ref Sequence ENSEMBL: ENSMUSP00000130422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032818] [ENSMUST00000056078] [ENSMUST00000094632] [ENSMUST00000108278] [ENSMUST00000108279] [ENSMUST00000165004] [ENSMUST00000167118] [ENSMUST00000171183] [ENSMUST00000207877]
Predicted Effect probably damaging
Transcript: ENSMUST00000032818
AA Change: R284H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032818
Gene: ENSMUSG00000030598
AA Change: R284H

DomainStartEndE-ValueType
FBOX 21 62 7.7e-6 SMART
low complexity region 83 92 N/A INTRINSIC
FBA 101 283 7.76e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056078
SMART Domains Protein: ENSMUSP00000062066
Gene: ENSMUSG00000045948

DomainStartEndE-ValueType
Pfam:Ribosom_S12_S23 31 139 2.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094632
SMART Domains Protein: ENSMUSP00000092216
Gene: ENSMUSG00000070699

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 58 174 3.8e-8 PFAM
Pfam:tRNA-synt_2b 284 468 5.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108278
AA Change: R284H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103913
Gene: ENSMUSG00000030598
AA Change: R284H

DomainStartEndE-ValueType
FBOX 21 62 7.7e-6 SMART
low complexity region 83 92 N/A INTRINSIC
FBA 101 283 7.76e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108279
SMART Domains Protein: ENSMUSP00000103914
Gene: ENSMUSG00000030598

DomainStartEndE-ValueType
FBOX 21 62 7.7e-6 SMART
low complexity region 83 92 N/A INTRINSIC
FBA 101 242 1.34e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165004
SMART Domains Protein: ENSMUSP00000129492
Gene: ENSMUSG00000045948

DomainStartEndE-ValueType
Pfam:Ribosom_S12_S23 23 125 3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165246
Predicted Effect probably damaging
Transcript: ENSMUST00000167118
AA Change: R284H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130422
Gene: ENSMUSG00000030598
AA Change: R284H

DomainStartEndE-ValueType
FBOX 21 62 7.7e-6 SMART
low complexity region 83 92 N/A INTRINSIC
FBA 101 283 7.76e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171183
SMART Domains Protein: ENSMUSP00000132443
Gene: ENSMUSG00000045948

DomainStartEndE-ValueType
Pfam:Ribosom_S12_S23 31 139 2.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207897
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by the F-box motif. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it contains an F-box domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Fbxo17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Fbxo17 APN 7 28735341 missense probably damaging 1.00
IGL03306:Fbxo17 APN 7 28735357 missense probably damaging 1.00
R0141:Fbxo17 UTSW 7 28733491 missense possibly damaging 0.59
R0144:Fbxo17 UTSW 7 28735340 missense probably damaging 1.00
R0418:Fbxo17 UTSW 7 28733491 missense possibly damaging 0.59
R1166:Fbxo17 UTSW 7 28733528 missense probably damaging 1.00
R3691:Fbxo17 UTSW 7 28737462 missense probably damaging 0.99
R4688:Fbxo17 UTSW 7 28732554 missense probably benign
R4921:Fbxo17 UTSW 7 28732789 missense probably benign 0.14
R5691:Fbxo17 UTSW 7 28737472 missense probably damaging 1.00
R5712:Fbxo17 UTSW 7 28737472 missense probably damaging 1.00
R5750:Fbxo17 UTSW 7 28737472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGGGAGTCTGCTAAGATGG -3'
(R):5'- GTAGTCCCTGCTTGAGAGACAG -3'

Sequencing Primer
(F):5'- TCTGCTAAGATGGAAGAGGGGTC -3'
(R):5'- CCCTGCTTGAGAGACAGAAGCTATG -3'
Posted On2016-11-21