Incidental Mutation 'R5750:Fbxo17'
ID445965
Institutional Source Beutler Lab
Gene Symbol Fbxo17
Ensembl Gene ENSMUSG00000030598
Gene NameF-box protein 17
SynonymsFbg4, Fbx17, FBXO26
MMRRC Submission 043356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5750 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28716804-28738144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28737472 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 284 (R284H)
Ref Sequence ENSEMBL: ENSMUSP00000130422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032818] [ENSMUST00000056078] [ENSMUST00000094632] [ENSMUST00000108278] [ENSMUST00000108279] [ENSMUST00000165004] [ENSMUST00000167118] [ENSMUST00000171183] [ENSMUST00000207877]
Predicted Effect probably damaging
Transcript: ENSMUST00000032818
AA Change: R284H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032818
Gene: ENSMUSG00000030598
AA Change: R284H

DomainStartEndE-ValueType
FBOX 21 62 7.7e-6 SMART
low complexity region 83 92 N/A INTRINSIC
FBA 101 283 7.76e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056078
SMART Domains Protein: ENSMUSP00000062066
Gene: ENSMUSG00000045948

DomainStartEndE-ValueType
Pfam:Ribosom_S12_S23 31 139 2.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094632
SMART Domains Protein: ENSMUSP00000092216
Gene: ENSMUSG00000070699

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 58 174 3.8e-8 PFAM
Pfam:tRNA-synt_2b 284 468 5.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108278
AA Change: R284H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103913
Gene: ENSMUSG00000030598
AA Change: R284H

DomainStartEndE-ValueType
FBOX 21 62 7.7e-6 SMART
low complexity region 83 92 N/A INTRINSIC
FBA 101 283 7.76e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108279
SMART Domains Protein: ENSMUSP00000103914
Gene: ENSMUSG00000030598

DomainStartEndE-ValueType
FBOX 21 62 7.7e-6 SMART
low complexity region 83 92 N/A INTRINSIC
FBA 101 242 1.34e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165004
SMART Domains Protein: ENSMUSP00000129492
Gene: ENSMUSG00000045948

DomainStartEndE-ValueType
Pfam:Ribosom_S12_S23 23 125 3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165246
Predicted Effect probably damaging
Transcript: ENSMUST00000167118
AA Change: R284H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130422
Gene: ENSMUSG00000030598
AA Change: R284H

DomainStartEndE-ValueType
FBOX 21 62 7.7e-6 SMART
low complexity region 83 92 N/A INTRINSIC
FBA 101 283 7.76e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171183
SMART Domains Protein: ENSMUSP00000132443
Gene: ENSMUSG00000045948

DomainStartEndE-ValueType
Pfam:Ribosom_S12_S23 31 139 2.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207897
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by the F-box motif. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it contains an F-box domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmat G A 4: 141,749,687 V135I probably benign Het
Agr3 T C 12: 35,946,942 Y72H probably benign Het
Ankhd1 T A 18: 36,624,902 M883K probably benign Het
Cpeb1 A T 7: 81,436,351 D9E probably benign Het
Creb3l1 C T 2: 91,986,263 V386M possibly damaging Het
Dnlz C T 2: 26,351,411 V102M probably damaging Het
Esp4 C T 17: 40,602,395 T51M probably benign Het
Fam208b G A 13: 3,573,642 Q1421* probably null Het
Fap C A 2: 62,528,714 C443F probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Fshr T A 17: 88,986,241 L336F probably benign Het
Gm9992 C T 17: 7,369,731 V133I probably benign Het
Gna15 G A 10: 81,509,396 Q212* probably null Het
Hk1 A G 10: 62,274,466 F785L possibly damaging Het
Ints8 T A 4: 11,241,654 Q263L possibly damaging Het
Itgax T C 7: 128,144,706 F880L probably benign Het
Kcnq4 A C 4: 120,715,049 V327G probably damaging Het
Kdm4a A G 4: 118,142,199 probably benign Het
Leng8 C T 7: 4,142,120 S173L probably benign Het
Lrrc37a C T 11: 103,458,097 D2591N unknown Het
Macrod2 T A 2: 141,515,320 S179T probably benign Het
Map4k2 T A 19: 6,351,337 S612R probably benign Het
Mast2 A G 4: 116,308,889 probably benign Het
Micall2 C T 5: 139,715,701 probably null Het
Miga2 T A 2: 30,371,565 W191R probably damaging Het
Mterf1b T C 5: 4,196,683 I108T probably damaging Het
Myh2 A G 11: 67,191,428 I1319V probably benign Het
Nalcn T C 14: 123,572,038 E234G probably benign Het
Ncoa4 T A 14: 32,177,307 C602* probably null Het
Ntrk2 C A 13: 58,808,922 P65Q probably benign Het
Olfr625-ps1 G A 7: 103,683,155 V136I possibly damaging Het
Olfr811 C T 10: 129,801,620 V302M probably benign Het
P3h1 A T 4: 119,238,666 I324F probably damaging Het
Peli2 G T 14: 48,256,175 V285L possibly damaging Het
Qser1 A G 2: 104,788,923 S515P probably damaging Het
Rnf31 C T 14: 55,598,686 R721C probably damaging Het
Rps5 A G 7: 12,925,407 K42E probably damaging Het
Rufy4 A T 1: 74,132,909 T264S probably benign Het
Shq1 A T 6: 100,611,814 V259D possibly damaging Het
Slc22a3 T C 17: 12,433,508 I410V probably benign Het
Stx5a T C 19: 8,755,137 probably benign Het
Syne1 G T 10: 5,339,209 H1430Q probably benign Het
Tmem126b A C 7: 90,469,657 V141G probably damaging Het
Trim52 C A 14: 106,107,498 Q197K probably benign Het
Tshz1 A G 18: 84,013,961 L774P possibly damaging Het
Ttn T C 2: 76,771,687 S10217G possibly damaging Het
Unc45a A G 7: 80,334,823 V228A probably benign Het
Vwa2 G T 19: 56,909,231 G656V probably benign Het
Xpo5 T C 17: 46,218,630 probably null Het
Zeb2 T A 2: 44,997,518 Q494L probably damaging Het
Other mutations in Fbxo17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Fbxo17 APN 7 28735341 missense probably damaging 1.00
IGL03306:Fbxo17 APN 7 28735357 missense probably damaging 1.00
R0141:Fbxo17 UTSW 7 28733491 missense possibly damaging 0.59
R0144:Fbxo17 UTSW 7 28735340 missense probably damaging 1.00
R0418:Fbxo17 UTSW 7 28733491 missense possibly damaging 0.59
R1166:Fbxo17 UTSW 7 28733528 missense probably damaging 1.00
R3691:Fbxo17 UTSW 7 28737462 missense probably damaging 0.99
R4688:Fbxo17 UTSW 7 28732554 missense probably benign
R4921:Fbxo17 UTSW 7 28732789 missense probably benign 0.14
R5691:Fbxo17 UTSW 7 28737472 missense probably damaging 1.00
R5712:Fbxo17 UTSW 7 28737472 missense probably damaging 1.00
R5749:Fbxo17 UTSW 7 28737472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGAGTCTGCTAAGATGG -3'
(R):5'- ATGGTAGTCCCTGCTTGAGAG -3'

Sequencing Primer
(F):5'- TCTGCTAAGATGGAAGAGGGGTC -3'
(R):5'- TCCCTGCTTGAGAGACAGAAGC -3'
Posted On2016-11-21