Incidental Mutation 'R5750:Itgax'
ID445970
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 043356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5750 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128144706 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 880 (F880L)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
Predicted Effect probably benign
Transcript: ENSMUST00000033053
AA Change: F880L

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: F880L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206396
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmat G A 4: 141,749,687 V135I probably benign Het
Agr3 T C 12: 35,946,942 Y72H probably benign Het
Ankhd1 T A 18: 36,624,902 M883K probably benign Het
Cpeb1 A T 7: 81,436,351 D9E probably benign Het
Creb3l1 C T 2: 91,986,263 V386M possibly damaging Het
Dnlz C T 2: 26,351,411 V102M probably damaging Het
Esp4 C T 17: 40,602,395 T51M probably benign Het
Fam208b G A 13: 3,573,642 Q1421* probably null Het
Fap C A 2: 62,528,714 C443F probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Fshr T A 17: 88,986,241 L336F probably benign Het
Gm9992 C T 17: 7,369,731 V133I probably benign Het
Gna15 G A 10: 81,509,396 Q212* probably null Het
Hk1 A G 10: 62,274,466 F785L possibly damaging Het
Ints8 T A 4: 11,241,654 Q263L possibly damaging Het
Kcnq4 A C 4: 120,715,049 V327G probably damaging Het
Kdm4a A G 4: 118,142,199 probably benign Het
Leng8 C T 7: 4,142,120 S173L probably benign Het
Lrrc37a C T 11: 103,458,097 D2591N unknown Het
Macrod2 T A 2: 141,515,320 S179T probably benign Het
Map4k2 T A 19: 6,351,337 S612R probably benign Het
Mast2 A G 4: 116,308,889 probably benign Het
Micall2 C T 5: 139,715,701 probably null Het
Miga2 T A 2: 30,371,565 W191R probably damaging Het
Mterf1b T C 5: 4,196,683 I108T probably damaging Het
Myh2 A G 11: 67,191,428 I1319V probably benign Het
Nalcn T C 14: 123,572,038 E234G probably benign Het
Ncoa4 T A 14: 32,177,307 C602* probably null Het
Ntrk2 C A 13: 58,808,922 P65Q probably benign Het
Olfr625-ps1 G A 7: 103,683,155 V136I possibly damaging Het
Olfr811 C T 10: 129,801,620 V302M probably benign Het
P3h1 A T 4: 119,238,666 I324F probably damaging Het
Peli2 G T 14: 48,256,175 V285L possibly damaging Het
Qser1 A G 2: 104,788,923 S515P probably damaging Het
Rnf31 C T 14: 55,598,686 R721C probably damaging Het
Rps5 A G 7: 12,925,407 K42E probably damaging Het
Rufy4 A T 1: 74,132,909 T264S probably benign Het
Shq1 A T 6: 100,611,814 V259D possibly damaging Het
Slc22a3 T C 17: 12,433,508 I410V probably benign Het
Stx5a T C 19: 8,755,137 probably benign Het
Syne1 G T 10: 5,339,209 H1430Q probably benign Het
Tmem126b A C 7: 90,469,657 V141G probably damaging Het
Trim52 C A 14: 106,107,498 Q197K probably benign Het
Tshz1 A G 18: 84,013,961 L774P possibly damaging Het
Ttn T C 2: 76,771,687 S10217G possibly damaging Het
Unc45a A G 7: 80,334,823 V228A probably benign Het
Vwa2 G T 19: 56,909,231 G656V probably benign Het
Xpo5 T C 17: 46,218,630 probably null Het
Zeb2 T A 2: 44,997,518 Q494L probably damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TACACAACAGGAGGTTTGACC -3'
(R):5'- TTCCCACTCTGGCTCTTAGAAG -3'

Sequencing Primer
(F):5'- GTTTGACCAGACATCGATGC -3'
(R):5'- ACTCTGGCTCTTAGAAGCAGCC -3'
Posted On2016-11-21