Incidental Mutation 'R5750:Olfr811'
ID445974
Institutional Source Beutler Lab
Gene Symbol Olfr811
Ensembl Gene ENSMUSG00000063173
Gene Nameolfactory receptor 811
SynonymsMOR110-6, GA_x6K02T2PULF-11481207-11480248
MMRRC Submission 043356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5750 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129800615-129804396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129801620 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 302 (V302M)
Ref Sequence ENSEMBL: ENSMUSP00000149970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076437] [ENSMUST00000215058] [ENSMUST00000217571]
Predicted Effect probably benign
Transcript: ENSMUST00000076437
AA Change: V302M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075768
Gene: ENSMUSG00000063173
AA Change: V302M

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.1e-51 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215058
AA Change: V302M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216283
Predicted Effect probably benign
Transcript: ENSMUST00000217571
AA Change: V302M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmat G A 4: 141,749,687 V135I probably benign Het
Agr3 T C 12: 35,946,942 Y72H probably benign Het
Ankhd1 T A 18: 36,624,902 M883K probably benign Het
Cpeb1 A T 7: 81,436,351 D9E probably benign Het
Creb3l1 C T 2: 91,986,263 V386M possibly damaging Het
Dnlz C T 2: 26,351,411 V102M probably damaging Het
Esp4 C T 17: 40,602,395 T51M probably benign Het
Fam208b G A 13: 3,573,642 Q1421* probably null Het
Fap C A 2: 62,528,714 C443F probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Fshr T A 17: 88,986,241 L336F probably benign Het
Gm9992 C T 17: 7,369,731 V133I probably benign Het
Gna15 G A 10: 81,509,396 Q212* probably null Het
Hk1 A G 10: 62,274,466 F785L possibly damaging Het
Ints8 T A 4: 11,241,654 Q263L possibly damaging Het
Itgax T C 7: 128,144,706 F880L probably benign Het
Kcnq4 A C 4: 120,715,049 V327G probably damaging Het
Kdm4a A G 4: 118,142,199 probably benign Het
Leng8 C T 7: 4,142,120 S173L probably benign Het
Lrrc37a C T 11: 103,458,097 D2591N unknown Het
Macrod2 T A 2: 141,515,320 S179T probably benign Het
Map4k2 T A 19: 6,351,337 S612R probably benign Het
Mast2 A G 4: 116,308,889 probably benign Het
Micall2 C T 5: 139,715,701 probably null Het
Miga2 T A 2: 30,371,565 W191R probably damaging Het
Mterf1b T C 5: 4,196,683 I108T probably damaging Het
Myh2 A G 11: 67,191,428 I1319V probably benign Het
Nalcn T C 14: 123,572,038 E234G probably benign Het
Ncoa4 T A 14: 32,177,307 C602* probably null Het
Ntrk2 C A 13: 58,808,922 P65Q probably benign Het
Olfr625-ps1 G A 7: 103,683,155 V136I possibly damaging Het
P3h1 A T 4: 119,238,666 I324F probably damaging Het
Peli2 G T 14: 48,256,175 V285L possibly damaging Het
Qser1 A G 2: 104,788,923 S515P probably damaging Het
Rnf31 C T 14: 55,598,686 R721C probably damaging Het
Rps5 A G 7: 12,925,407 K42E probably damaging Het
Rufy4 A T 1: 74,132,909 T264S probably benign Het
Shq1 A T 6: 100,611,814 V259D possibly damaging Het
Slc22a3 T C 17: 12,433,508 I410V probably benign Het
Stx5a T C 19: 8,755,137 probably benign Het
Syne1 G T 10: 5,339,209 H1430Q probably benign Het
Tmem126b A C 7: 90,469,657 V141G probably damaging Het
Trim52 C A 14: 106,107,498 Q197K probably benign Het
Tshz1 A G 18: 84,013,961 L774P possibly damaging Het
Ttn T C 2: 76,771,687 S10217G possibly damaging Het
Unc45a A G 7: 80,334,823 V228A probably benign Het
Vwa2 G T 19: 56,909,231 G656V probably benign Het
Xpo5 T C 17: 46,218,630 probably null Het
Zeb2 T A 2: 44,997,518 Q494L probably damaging Het
Other mutations in Olfr811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Olfr811 APN 10 129801907 missense possibly damaging 0.64
IGL01957:Olfr811 APN 10 129802250 missense probably damaging 1.00
IGL02394:Olfr811 APN 10 129802313 missense possibly damaging 0.90
IGL02451:Olfr811 APN 10 129801833 nonsense probably null
IGL03111:Olfr811 APN 10 129802078 missense probably benign 0.00
IGL03369:Olfr811 APN 10 129802471 missense probably damaging 0.99
R0704:Olfr811 UTSW 10 129802303 missense probably benign 0.01
R1393:Olfr811 UTSW 10 129801932 missense probably benign 0.22
R1941:Olfr811 UTSW 10 129802412 missense probably benign 0.00
R1994:Olfr811 UTSW 10 129801661 missense probably damaging 1.00
R3427:Olfr811 UTSW 10 129801851 missense possibly damaging 0.85
R4296:Olfr811 UTSW 10 129802300 missense probably damaging 0.97
R4937:Olfr811 UTSW 10 129802063 missense probably benign 0.31
R5016:Olfr811 UTSW 10 129801793 missense probably benign 0.01
R5615:Olfr811 UTSW 10 129801767 missense probably damaging 1.00
R5662:Olfr811 UTSW 10 129802307 missense possibly damaging 0.83
R6109:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6109:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6395:Olfr811 UTSW 10 129802144 missense probably damaging 1.00
R6440:Olfr811 UTSW 10 129801968 missense probably damaging 1.00
R6559:Olfr811 UTSW 10 129801664 missense probably damaging 1.00
R6707:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6708:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6868:Olfr811 UTSW 10 129802168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACTCACATTCTAAAGTTAGGGAG -3'
(R):5'- CTGTACCTCCCACATGGTTG -3'

Sequencing Primer
(F):5'- TTCTAAAGTTAGGGAGATGTACTGAG -3'
(R):5'- GTACCTCCCACATGGTTGTTGTC -3'
Posted On2016-11-21