Incidental Mutation 'R5751:Gtf3c4'
ID445998
Institutional Source Beutler Lab
Gene Symbol Gtf3c4
Ensembl Gene ENSMUSG00000035666
Gene Namegeneral transcription factor IIIC, polypeptide 4
SynonymsKAT12
MMRRC Submission 043201-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R5751 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28822299-28840360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28827499 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 790 (A790T)
Ref Sequence ENSEMBL: ENSMUSP00000042265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037117] [ENSMUST00000171404]
Predicted Effect probably damaging
Transcript: ENSMUST00000037117
AA Change: A790T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042265
Gene: ENSMUSG00000035666
AA Change: A790T

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:TFIIIC_delta 59 250 1.1e-45 PFAM
low complexity region 609 621 N/A INTRINSIC
Pfam:zf-TFIIIC 728 816 2.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171404
AA Change: A649T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132171
Gene: ENSMUSG00000035666
AA Change: A649T

DomainStartEndE-ValueType
Pfam:TFIIIC_delta 7 109 3.1e-17 PFAM
low complexity region 468 480 N/A INTRINSIC
Pfam:zf-TFIIIC 587 676 4.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,230,832 T1704A possibly damaging Het
Adam6a T A 12: 113,544,827 D273E possibly damaging Het
Adgrv1 T A 13: 81,522,236 L1610F probably damaging Het
Ago2 C T 15: 73,128,323 probably null Het
Apob T A 12: 8,012,619 Y87* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp7b A G 8: 22,018,128 V599A probably damaging Het
Dnah1 T A 14: 31,310,906 I391F probably benign Het
Emc2 A G 15: 43,497,057 probably null Het
Gbp9 G T 5: 105,081,258 Q508K probably benign Het
Gm853 A C 4: 130,220,441 V61G probably benign Het
Grpel1 C T 5: 36,469,467 T31M probably benign Het
Hmcn1 A G 1: 150,573,554 C115R probably damaging Het
Ik G A 18: 36,753,513 R346H probably benign Het
Lhx3 A G 2: 26,201,161 S379P probably benign Het
Mocs1 A G 17: 49,449,738 probably null Het
Mycbp2 C A 14: 103,148,550 V3457F probably damaging Het
Olfr1239 A T 2: 89,417,687 I242N probably damaging Het
Olfr128 A T 17: 37,923,970 I135L probably benign Het
Olfr1440 G A 19: 12,394,416 R51K probably benign Het
Orc5 C T 5: 22,499,971 probably null Het
Phf20 T C 2: 156,267,341 S203P probably benign Het
Pkd1l1 T C 11: 8,867,204 S1815G possibly damaging Het
Pnpla7 T C 2: 24,981,778 V11A probably damaging Het
Ranbp2 T C 10: 58,464,264 probably null Het
Ranbp3l A G 15: 9,063,089 D326G probably damaging Het
Rsph4a C T 10: 33,905,793 A213V probably damaging Het
Sema3b A G 9: 107,599,714 S570P probably benign Het
Spata31d1b T A 13: 59,718,973 C1312S probably benign Het
Sphkap G T 1: 83,275,897 T1377K probably benign Het
Stk32a A T 18: 43,305,020 R195W possibly damaging Het
Tacr2 T C 10: 62,252,990 I58T probably damaging Het
Tmem200c A T 17: 68,840,552 K43N probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Uckl1 A G 2: 181,574,452 S167P possibly damaging Het
Vmn2r90 A G 17: 17,733,866 Y764C probably damaging Het
Zan C T 5: 137,410,161 probably null Het
Other mutations in Gtf3c4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Gtf3c4 APN 2 28833572 missense probably benign
IGL01419:Gtf3c4 APN 2 28835069 missense probably damaging 1.00
IGL01574:Gtf3c4 APN 2 28834436 missense possibly damaging 0.50
IGL01778:Gtf3c4 APN 2 28835088 missense probably damaging 1.00
IGL01802:Gtf3c4 APN 2 28834080 missense probably damaging 1.00
IGL02560:Gtf3c4 APN 2 28834267 nonsense probably null
R0190:Gtf3c4 UTSW 2 28840128 missense probably benign 0.19
R0245:Gtf3c4 UTSW 2 28834964 missense possibly damaging 0.71
R0440:Gtf3c4 UTSW 2 28840169 unclassified probably null
R0882:Gtf3c4 UTSW 2 28834770 missense probably damaging 1.00
R1757:Gtf3c4 UTSW 2 28830636 splice site probably benign
R1809:Gtf3c4 UTSW 2 28833976 nonsense probably null
R1893:Gtf3c4 UTSW 2 28834362 missense possibly damaging 0.92
R1903:Gtf3c4 UTSW 2 28839956 missense probably benign 0.19
R2020:Gtf3c4 UTSW 2 28833894 missense possibly damaging 0.81
R2867:Gtf3c4 UTSW 2 28839904 utr 5 prime probably benign
R3076:Gtf3c4 UTSW 2 28835153 missense possibly damaging 0.56
R4113:Gtf3c4 UTSW 2 28827555 missense probably damaging 1.00
R4404:Gtf3c4 UTSW 2 28826749 missense probably damaging 1.00
R5997:Gtf3c4 UTSW 2 28833711 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTGAGTCAGCCCTAACACTGG -3'
(R):5'- CAGAGAGGTTCTGTGTCTCTTCAG -3'

Sequencing Primer
(F):5'- GTCAGCCCTAACACTGGACTGAAG -3'
(R):5'- CTCTTCAGAGAGTGCTGGTATAG -3'
Posted On2016-11-21