Incidental Mutation 'R5751:Tnik'
ID446002
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission 043201-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5751 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28594092 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 431 (M431T)
Ref Sequence ENSEMBL: ENSMUSP00000124681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect probably benign
Transcript: ENSMUST00000159236
AA Change: M431T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: M431T

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159308
AA Change: M431T
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: M431T

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159680
AA Change: M431T
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: M431T

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160307
AA Change: M431T
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: M431T

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160518
AA Change: M431T
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: M431T

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161423
Predicted Effect unknown
Transcript: ENSMUST00000161964
AA Change: M431T
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: M431T

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect unknown
Transcript: ENSMUST00000162485
AA Change: M431T
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: M431T

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162777
AA Change: M431T
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: M431T

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,230,832 T1704A possibly damaging Het
Adam6a T A 12: 113,544,827 D273E possibly damaging Het
Adgrv1 T A 13: 81,522,236 L1610F probably damaging Het
Ago2 C T 15: 73,128,323 probably null Het
Apob T A 12: 8,012,619 Y87* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp7b A G 8: 22,018,128 V599A probably damaging Het
Dnah1 T A 14: 31,310,906 I391F probably benign Het
Emc2 A G 15: 43,497,057 probably null Het
Gbp9 G T 5: 105,081,258 Q508K probably benign Het
Gm853 A C 4: 130,220,441 V61G probably benign Het
Grpel1 C T 5: 36,469,467 T31M probably benign Het
Gtf3c4 C T 2: 28,827,499 A790T probably damaging Het
Hmcn1 A G 1: 150,573,554 C115R probably damaging Het
Ik G A 18: 36,753,513 R346H probably benign Het
Lhx3 A G 2: 26,201,161 S379P probably benign Het
Mocs1 A G 17: 49,449,738 probably null Het
Mycbp2 C A 14: 103,148,550 V3457F probably damaging Het
Olfr1239 A T 2: 89,417,687 I242N probably damaging Het
Olfr128 A T 17: 37,923,970 I135L probably benign Het
Olfr1440 G A 19: 12,394,416 R51K probably benign Het
Orc5 C T 5: 22,499,971 probably null Het
Phf20 T C 2: 156,267,341 S203P probably benign Het
Pkd1l1 T C 11: 8,867,204 S1815G possibly damaging Het
Pnpla7 T C 2: 24,981,778 V11A probably damaging Het
Ranbp2 T C 10: 58,464,264 probably null Het
Ranbp3l A G 15: 9,063,089 D326G probably damaging Het
Rsph4a C T 10: 33,905,793 A213V probably damaging Het
Sema3b A G 9: 107,599,714 S570P probably benign Het
Spata31d1b T A 13: 59,718,973 C1312S probably benign Het
Sphkap G T 1: 83,275,897 T1377K probably benign Het
Stk32a A T 18: 43,305,020 R195W possibly damaging Het
Tacr2 T C 10: 62,252,990 I58T probably damaging Het
Tmem200c A T 17: 68,840,552 K43N probably damaging Het
Uckl1 A G 2: 181,574,452 S167P possibly damaging Het
Vmn2r90 A G 17: 17,733,866 Y764C probably damaging Het
Zan C T 5: 137,410,161 probably null Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATGGCAAGTACTGAAGTGGTC -3'
(R):5'- GGCATTTTCAAGCTGTGCAC -3'

Sequencing Primer
(F):5'- GTACTGAAGTGGTCTCCATAACC -3'
(R):5'- CAAGCTGTGCACTTGACATTTTG -3'
Posted On2016-11-21