Incidental Mutation 'R5751:Tacr2'
ID446011
Institutional Source Beutler Lab
Gene Symbol Tacr2
Ensembl Gene ENSMUSG00000020081
Gene Nametachykinin receptor 2
SynonymsTac2r
MMRRC Submission 043201-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5751 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62252438-62265990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62252990 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 58 (I58T)
Ref Sequence ENSEMBL: ENSMUSP00000020278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020278]
Predicted Effect probably damaging
Transcript: ENSMUST00000020278
AA Change: I58T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020278
Gene: ENSMUSG00000020081
AA Change: I58T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 322 1.9e-11 PFAM
Pfam:7tm_1 50 307 4e-58 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of genes that function as receptors for tachykinins. Receptor affinities are specified by variations in the 5'-end of the sequence. The receptors belonging to this family are characterized by interactions with G proteins and 7 hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin neuropeptide substance K, also referred to as neurokinin A. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,230,832 T1704A possibly damaging Het
Adam6a T A 12: 113,544,827 D273E possibly damaging Het
Adgrv1 T A 13: 81,522,236 L1610F probably damaging Het
Ago2 C T 15: 73,128,323 probably null Het
Apob T A 12: 8,012,619 Y87* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp7b A G 8: 22,018,128 V599A probably damaging Het
Dnah1 T A 14: 31,310,906 I391F probably benign Het
Emc2 A G 15: 43,497,057 probably null Het
Gbp9 G T 5: 105,081,258 Q508K probably benign Het
Gm853 A C 4: 130,220,441 V61G probably benign Het
Grpel1 C T 5: 36,469,467 T31M probably benign Het
Gtf3c4 C T 2: 28,827,499 A790T probably damaging Het
Hmcn1 A G 1: 150,573,554 C115R probably damaging Het
Ik G A 18: 36,753,513 R346H probably benign Het
Lhx3 A G 2: 26,201,161 S379P probably benign Het
Mocs1 A G 17: 49,449,738 probably null Het
Mycbp2 C A 14: 103,148,550 V3457F probably damaging Het
Olfr1239 A T 2: 89,417,687 I242N probably damaging Het
Olfr128 A T 17: 37,923,970 I135L probably benign Het
Olfr1440 G A 19: 12,394,416 R51K probably benign Het
Orc5 C T 5: 22,499,971 probably null Het
Phf20 T C 2: 156,267,341 S203P probably benign Het
Pkd1l1 T C 11: 8,867,204 S1815G possibly damaging Het
Pnpla7 T C 2: 24,981,778 V11A probably damaging Het
Ranbp2 T C 10: 58,464,264 probably null Het
Ranbp3l A G 15: 9,063,089 D326G probably damaging Het
Rsph4a C T 10: 33,905,793 A213V probably damaging Het
Sema3b A G 9: 107,599,714 S570P probably benign Het
Spata31d1b T A 13: 59,718,973 C1312S probably benign Het
Sphkap G T 1: 83,275,897 T1377K probably benign Het
Stk32a A T 18: 43,305,020 R195W possibly damaging Het
Tmem200c A T 17: 68,840,552 K43N probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Uckl1 A G 2: 181,574,452 S167P possibly damaging Het
Vmn2r90 A G 17: 17,733,866 Y764C probably damaging Het
Zan C T 5: 137,410,161 probably null Het
Other mutations in Tacr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Tacr2 APN 10 62261690 splice site probably benign
R1538:Tacr2 UTSW 10 62261327 critical splice donor site probably null
R3161:Tacr2 UTSW 10 62265245 missense probably benign 0.16
R3162:Tacr2 UTSW 10 62265245 missense probably benign 0.16
R3162:Tacr2 UTSW 10 62265245 missense probably benign 0.16
R3889:Tacr2 UTSW 10 62265086 missense probably damaging 1.00
R4193:Tacr2 UTSW 10 62253179 missense probably damaging 1.00
R4801:Tacr2 UTSW 10 62261548 missense probably damaging 1.00
R4802:Tacr2 UTSW 10 62261548 missense probably damaging 1.00
R5382:Tacr2 UTSW 10 62261497 missense probably damaging 1.00
R7064:Tacr2 UTSW 10 62261497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGACGGAACTGCAGGG -3'
(R):5'- TGACGAACATGGCTGTGAC -3'

Sequencing Primer
(F):5'- TGTTCCAGGCCCAGGATCAG -3'
(R):5'- CTGTGACAGGAAAGAGGTTCTG -3'
Posted On2016-11-21