Incidental Mutation 'R5762:Unc80'
ID446027
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Nameunc-80, NALCN activator
SynonymsC030018G13Rik, C230061B10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R5762 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66468367-66699148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66693796 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 3101 (K3101N)
Ref Sequence ENSEMBL: ENSMUSP00000148517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061620
AA Change: K3169N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: K3169N

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152844
AA Change: K123N
SMART Domains Protein: ENSMUSP00000117070
Gene: ENSMUSG00000055567
AA Change: K123N

DomainStartEndE-ValueType
low complexity region 76 99 N/A INTRINSIC
low complexity region 200 209 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192513
Predicted Effect possibly damaging
Transcript: ENSMUST00000212557
AA Change: K3101N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,896,598 D148E probably benign Het
Abca13 A G 11: 9,581,665 I4631V probably damaging Het
Adamts16 A T 13: 70,738,498 W1058R probably damaging Het
Adgrf5 A G 17: 43,430,695 I163V probably null Het
Ano1 T A 7: 144,648,037 Y338F probably damaging Het
Atp4a A G 7: 30,719,096 D603G probably damaging Het
B020031M17Rik T A 13: 119,949,965 Q35L probably benign Het
Bmp2k GGCCCGC GGC 5: 97,087,191 probably null Het
Brinp2 T C 1: 158,246,586 D655G probably benign Het
C3ar1 A G 6: 122,850,362 S299P probably benign Het
Calhm1 T A 19: 47,143,619 probably null Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Cd27 A G 6: 125,236,598 F48S probably damaging Het
Cfap52 A G 11: 67,954,121 Y41H possibly damaging Het
Cntn5 A G 9: 9,748,389 S701P possibly damaging Het
Ctbp2 G T 7: 132,995,359 A665D probably damaging Het
Ctsd C A 7: 142,383,529 G81C probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dpysl4 C T 7: 139,091,937 A67V probably benign Het
Dst C T 1: 34,179,357 T1626I probably damaging Het
Etfdh A C 3: 79,615,954 D217E probably null Het
Far1 T A 7: 113,568,189 Y494N probably damaging Het
Fndc1 G A 17: 7,771,534 T1110M unknown Het
Frmd4a G T 2: 4,484,065 D78Y probably damaging Het
Fsip2 G A 2: 82,977,916 M1526I probably benign Het
Ggn C T 7: 29,172,352 P399S probably damaging Het
Hap1 A G 11: 100,355,774 W102R probably damaging Het
Herc2 T A 7: 56,197,190 S3629R possibly damaging Het
Hist1h2ac C T 13: 23,683,905 G5S probably damaging Het
Hyal4 A C 6: 24,765,862 Y405S possibly damaging Het
Ifi204 G A 1: 173,752,759 T395I probably damaging Het
Igsf9 A G 1: 172,498,438 E1147G probably damaging Het
Inpp5a T A 7: 139,538,181 I225N possibly damaging Het
Kcnv1 T C 15: 45,109,122 K455R probably damaging Het
Kmt2c T C 5: 25,310,457 D2796G probably benign Het
Ngp A T 9: 110,422,333 D143V probably benign Het
Nlrp5 T C 7: 23,418,839 C663R possibly damaging Het
Nup205 G T 6: 35,227,680 R1469L probably damaging Het
Nup205 T A 6: 35,230,548 F1512I probably damaging Het
Nwd1 T C 8: 72,670,914 S594P probably damaging Het
Nxpe2 A C 9: 48,319,575 V498G probably benign Het
P3h4 G A 11: 100,411,851 R320C probably damaging Het
Plec A G 15: 76,179,255 L2273P probably damaging Het
Ppp1r14b C T 19: 6,976,583 L100F probably damaging Het
Prlhr C T 19: 60,467,068 W353* probably null Het
Ralgps2 C T 1: 156,832,664 probably null Het
Rrp12 C T 19: 41,880,152 G584D possibly damaging Het
Scamp3 T C 3: 89,181,197 F237L probably damaging Het
Scn10a A G 9: 119,635,441 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shroom1 A T 11: 53,463,991 D246V probably benign Het
Snapc4 T A 2: 26,378,606 E14D probably damaging Het
Spag5 A T 11: 78,304,146 Q93L probably benign Het
Tle1 C T 4: 72,120,135 probably null Het
Ttll10 G A 4: 156,034,981 P683S possibly damaging Het
Unc13c A C 9: 73,812,367 D1006E probably benign Het
Vdac1 A G 11: 52,387,453 Y247C possibly damaging Het
Vmn2r1 G A 3: 64,090,053 V377I probably benign Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Xrcc3 C T 12: 111,804,610 R295Q probably damaging Het
Zfp780b T C 7: 27,964,818 N104S probably benign Het
Zkscan17 A G 11: 59,487,571 V262A possibly damaging Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66510881 missense probably damaging 1.00
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0626:Unc80 UTSW 1 66608442 missense probably benign 0.01
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1834:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66510717 missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66510625 missense probably damaging 1.00
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2035:Unc80 UTSW 1 66606593 missense probably damaging 0.98
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66527941 missense probably damaging 0.97
R4888:Unc80 UTSW 1 66644447 missense probably damaging 0.98
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 intron probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6291:Unc80 UTSW 1 66521597 missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66549784 missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66521566 nonsense probably null
R7290:Unc80 UTSW 1 66601197 missense probably damaging 0.97
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTCCAAGGCTACAGGAAGGAAC -3'
(R):5'- TTACCTAGATTCACTGAGAATGGGG -3'

Sequencing Primer
(F):5'- AGCTGAGTCAGAGTCACCTG -3'
(R):5'- TTCACTGAGAATGGGGAGAGGTTG -3'
Posted On2016-11-21