Mutagenetix > Incidental Mutation

Incidental Mutation 'R5762:Cd27'

446049

Institutional Source

Beutler Lab

Gene Symbol

Cd27

Ensembl Gene

ENSMUSG00000030336

Gene Name

CD27 antigen

Synonyms

Tnfrsf7, S152, Cd27, Tp55

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5762 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125209585-125213973 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125213561 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 48 (F48S)

Ref Sequence

ENSEMBL: ENSMUSP00000107900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032486] [ENSMUST00000043422] [ENSMUST00000063588] [ENSMUST00000112281] [ENSMUST00000112282]

AlphaFold

P41272

Predicted Effect

probably damaging
Transcript: ENSMUST00000032486
AA Change: F48S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000032486
Gene: ENSMUSG00000030336
AA Change: F48S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TNFR	27	62	1.11e-2	SMART
TNFR	65	104	1.23e-4	SMART
low complexity region	131	147	N/A	INTRINSIC
transmembrane domain	183	202	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000043422

SMART Domains

Protein: ENSMUSP00000047105
Gene: ENSMUSG00000038213

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IG	202	306	1.11e-5	SMART
IGc1	321	397	3.97e-7	SMART
transmembrane domain	412	434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063588

SMART Domains

Protein: ENSMUSP00000063466
Gene: ENSMUSG00000030337

Domain	Start	End	E-Value	Type
low complexity region	3	26	N/A	INTRINSIC
Pfam:Synaptobrevin	30	118	5.4e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112281
AA Change: F48S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107900
Gene: ENSMUSG00000030336
AA Change: F48S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TNFR	27	62	1.11e-2	SMART
Blast:TNFR	65	100	4e-10	BLAST
transmembrane domain	120	142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112282

SMART Domains

Protein: ENSMUSP00000107901
Gene: ENSMUSG00000030336

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Blast:TNFR	27	45	1e-6	BLAST
transmembrane domain	76	98	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135205

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151527

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152650

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184956

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159547

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is required for generation and long-term maintenance of T cell immunity. It binds to ligand CD70, and plays a key role in regulating B-cell activation and immunoglobulin synthesis. This receptor transduces signals that lead to the activation of NF-kappaB and MAPK8/JNK. Adaptor proteins TRAF2 and TRAF5 have been shown to mediate the signaling process of this receptor. CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the apoptosis induced by this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a normal phenotype. However, T-cell development immune responses are abnormal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	T	5: 77,044,445 (GRCm39)	D148E	probably benign	Het
Abca13	A	G	11: 9,531,665 (GRCm39)	I4631V	probably damaging	Het
Adamts16	A	T	13: 70,886,617 (GRCm39)	W1058R	probably damaging	Het
Adgrf5	A	G	17: 43,741,586 (GRCm39)	I163V	probably null	Het
Ano1	T	A	7: 144,201,774 (GRCm39)	Y338F	probably damaging	Het
Atp4a	A	G	7: 30,418,521 (GRCm39)	D603G	probably damaging	Het
Bmp2k	GGCCCGC	GGC	5: 97,235,050 (GRCm39)		probably null	Het
Brinp2	T	C	1: 158,074,156 (GRCm39)	D655G	probably benign	Het
C3ar1	A	G	6: 122,827,321 (GRCm39)	S299P	probably benign	Het
Calhm1	T	A	19: 47,132,058 (GRCm39)		probably null	Het
Ccdc187	G	A	2: 26,166,104 (GRCm39)	P775L	possibly damaging	Het
Cfap52	A	G	11: 67,844,947 (GRCm39)	Y41H	possibly damaging	Het
Cntn5	A	G	9: 9,748,394 (GRCm39)	S701P	possibly damaging	Het
Ctbp2	G	T	7: 132,597,088 (GRCm39)	A665D	probably damaging	Het
Ctsd	C	A	7: 141,937,266 (GRCm39)	G81C	probably damaging	Het
Cybb	C	G	X: 9,316,989 (GRCm39)	D246H	probably benign	Het
Dpysl4	C	T	7: 138,671,853 (GRCm39)	A67V	probably benign	Het
Dst	C	T	1: 34,218,438 (GRCm39)	T1626I	probably damaging	Het
Etfdh	A	C	3: 79,523,261 (GRCm39)	D217E	probably null	Het
Far1	T	A	7: 113,167,396 (GRCm39)	Y494N	probably damaging	Het
Fndc1	G	A	17: 7,990,366 (GRCm39)	T1110M	unknown	Het
Frmd4a	G	T	2: 4,488,876 (GRCm39)	D78Y	probably damaging	Het
Fsip2	G	A	2: 82,808,260 (GRCm39)	M1526I	probably benign	Het
Ggn	C	T	7: 28,871,777 (GRCm39)	P399S	probably damaging	Het
H2ac6	C	T	13: 23,867,888 (GRCm39)	G5S	probably damaging	Het
Hap1	A	G	11: 100,246,600 (GRCm39)	W102R	probably damaging	Het
Herc2	T	A	7: 55,846,938 (GRCm39)	S3629R	possibly damaging	Het
Hyal4	A	C	6: 24,765,861 (GRCm39)	Y405S	possibly damaging	Het
Ifi204	G	A	1: 173,580,325 (GRCm39)	T395I	probably damaging	Het
Igsf9	A	G	1: 172,326,005 (GRCm39)	E1147G	probably damaging	Het
Inpp5a	T	A	7: 139,118,097 (GRCm39)	I225N	possibly damaging	Het
Kcnv1	T	C	15: 44,972,518 (GRCm39)	K455R	probably damaging	Het
Kmt2c	T	C	5: 25,515,455 (GRCm39)	D2796G	probably benign	Het
Ngp	A	T	9: 110,251,401 (GRCm39)	D143V	probably benign	Het
Nlrp5	T	C	7: 23,118,264 (GRCm39)	C663R	possibly damaging	Het
Nup205	G	T	6: 35,204,615 (GRCm39)	R1469L	probably damaging	Het
Nup205	T	A	6: 35,207,483 (GRCm39)	F1512I	probably damaging	Het
Nwd1	T	C	8: 73,397,542 (GRCm39)	S594P	probably damaging	Het
Nxpe2	A	C	9: 48,230,875 (GRCm39)	V498G	probably benign	Het
P3h4	G	A	11: 100,302,677 (GRCm39)	R320C	probably damaging	Het
Plec	A	G	15: 76,063,455 (GRCm39)	L2273P	probably damaging	Het
Ppp1r14b	C	T	19: 6,953,951 (GRCm39)	L100F	probably damaging	Het
Prlhr	C	T	19: 60,455,506 (GRCm39)	W353*	probably null	Het
Ralgps2	C	T	1: 156,660,234 (GRCm39)		probably null	Het
Rrp12	C	T	19: 41,868,591 (GRCm39)	G584D	possibly damaging	Het
Scamp3	T	C	3: 89,088,504 (GRCm39)	F237L	probably damaging	Het
Scn10a	A	G	9: 119,464,507 (GRCm39)		probably null	Het
Sh3bp5	C	A	14: 31,099,452 (GRCm39)	R265L	probably benign	Het
Shroom1	A	T	11: 53,354,818 (GRCm39)	D246V	probably benign	Het
Snapc4	T	A	2: 26,268,618 (GRCm39)	E14D	probably damaging	Het
Spag5	A	T	11: 78,194,972 (GRCm39)	Q93L	probably benign	Het
Tcstv5	T	A	13: 120,411,501 (GRCm39)	Q35L	probably benign	Het
Tle1	C	T	4: 72,038,372 (GRCm39)		probably null	Het
Ttll10	G	A	4: 156,119,438 (GRCm39)	P683S	possibly damaging	Het
Unc13c	A	C	9: 73,719,649 (GRCm39)	D1006E	probably benign	Het
Unc80	A	T	1: 66,732,955 (GRCm39)	K3101N	possibly damaging	Het
Vdac1	A	G	11: 52,278,280 (GRCm39)	Y247C	possibly damaging	Het
Vmn2r1	G	A	3: 63,997,474 (GRCm39)	V377I	probably benign	Het
Vmn2r23	A	G	6: 123,710,352 (GRCm39)	T552A	probably damaging	Het
Xrcc3	C	T	12: 111,771,044 (GRCm39)	R295Q	probably damaging	Het
Zfp780b	T	C	7: 27,664,243 (GRCm39)	N104S	probably benign	Het
Zkscan17	A	G	11: 59,378,397 (GRCm39)	V262A	possibly damaging	Het

Other mutations in Cd27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02222:Cd27	APN	6	125,211,495 (GRCm39)	missense	probably damaging	0.98
R2358:Cd27	UTSW	6	125,210,281 (GRCm39)	missense	probably damaging	1.00
R3704:Cd27	UTSW	6	125,210,361 (GRCm39)	missense	probably damaging	1.00
R3711:Cd27	UTSW	6	125,210,281 (GRCm39)	missense	probably damaging	1.00
R4305:Cd27	UTSW	6	125,211,633 (GRCm39)	missense	probably benign	0.02
R4872:Cd27	UTSW	6	125,211,281 (GRCm39)	critical splice acceptor site	probably null
R5369:Cd27	UTSW	6	125,211,327 (GRCm39)	intron	probably benign
R6577:Cd27	UTSW	6	125,213,756 (GRCm39)	missense	probably benign	0.00
R6810:Cd27	UTSW	6	125,210,627 (GRCm39)	missense	probably damaging	1.00
R8087:Cd27	UTSW	6	125,210,325 (GRCm39)	missense	possibly damaging	0.95
R8162:Cd27	UTSW	6	125,210,188 (GRCm39)	splice site	probably null
R8924:Cd27	UTSW	6	125,213,432 (GRCm39)	intron	probably benign
R9334:Cd27	UTSW	6	125,213,718 (GRCm39)	critical splice donor site	probably null
R9785:Cd27	UTSW	6	125,213,945 (GRCm39)	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GAAGCTCTCTGACTCCACAG -3'
(R):5'- ACAAACACTACTGGACTGGGG -3'

Sequencing Primer
(F):5'- TCTCTGACTCCACAGCCAGC -3'
(R):5'- ACTCTGCTGCCGGATGTG -3'

Posted On

2016-11-21