Incidental Mutation 'R5762:Ctsd'
ID446059
Institutional Source Beutler Lab
Gene Symbol Ctsd
Ensembl Gene ENSMUSG00000007891
Gene Namecathepsin D
SynonymsCD, CatD
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5762 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location142375911-142388038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 142383529 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 81 (G81C)
Ref Sequence ENSEMBL: ENSMUSP00000121203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066401] [ENSMUST00000151120]
Predicted Effect probably damaging
Transcript: ENSMUST00000066401
AA Change: G81C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063904
Gene: ENSMUSG00000007891
AA Change: G81C

DomainStartEndE-ValueType
Pfam:A1_Propeptide 21 49 1.7e-11 PFAM
Pfam:Asp 78 274 1.6e-75 PFAM
Pfam:TAXi_N 79 246 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133843
SMART Domains Protein: ENSMUSP00000117247
Gene: ENSMUSG00000110040

DomainStartEndE-ValueType
Pfam:Asp 1 249 4.5e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151120
AA Change: G81C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121203
Gene: ENSMUSG00000007891
AA Change: G81C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:A1_Propeptide 21 48 6.9e-11 PFAM
Pfam:Asp 78 407 4.7e-123 PFAM
Pfam:TAXi_N 79 247 2.1e-10 PFAM
Pfam:TAXi_C 326 406 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153679
Predicted Effect probably benign
Transcript: ENSMUST00000209263
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the A1 family of peptidases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the cathepsin D light and heavy chains, which heterodimerize to form the mature enzyme. This enzyme exhibits pepsin-like activity and plays a role in protein turnover and in the proteolytic activation of hormones and growth factors. Mutations in this gene play a causal role in neuronal ceroid lipofuscinosis-10 and may be involved in the pathogenesis of several other diseases, including breast cancer and possibly Alzheimer's disease. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null mutation die in a state of anorexia at ~P26, displaying severe atrophy of the intestinal mucosa, and massive destruction of the thymus and spleen with loss of T and B cells; near the terminal stage, affected mice have seizures,display retinal atrophy, and become blind. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,896,598 D148E probably benign Het
Abca13 A G 11: 9,581,665 I4631V probably damaging Het
Adamts16 A T 13: 70,738,498 W1058R probably damaging Het
Adgrf5 A G 17: 43,430,695 I163V probably null Het
Ano1 T A 7: 144,648,037 Y338F probably damaging Het
Atp4a A G 7: 30,719,096 D603G probably damaging Het
B020031M17Rik T A 13: 119,949,965 Q35L probably benign Het
Bmp2k GGCCCGC GGC 5: 97,087,191 probably null Het
Brinp2 T C 1: 158,246,586 D655G probably benign Het
C3ar1 A G 6: 122,850,362 S299P probably benign Het
Calhm1 T A 19: 47,143,619 probably null Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Cd27 A G 6: 125,236,598 F48S probably damaging Het
Cfap52 A G 11: 67,954,121 Y41H possibly damaging Het
Cntn5 A G 9: 9,748,389 S701P possibly damaging Het
Ctbp2 G T 7: 132,995,359 A665D probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dpysl4 C T 7: 139,091,937 A67V probably benign Het
Dst C T 1: 34,179,357 T1626I probably damaging Het
Etfdh A C 3: 79,615,954 D217E probably null Het
Far1 T A 7: 113,568,189 Y494N probably damaging Het
Fndc1 G A 17: 7,771,534 T1110M unknown Het
Frmd4a G T 2: 4,484,065 D78Y probably damaging Het
Fsip2 G A 2: 82,977,916 M1526I probably benign Het
Ggn C T 7: 29,172,352 P399S probably damaging Het
Hap1 A G 11: 100,355,774 W102R probably damaging Het
Herc2 T A 7: 56,197,190 S3629R possibly damaging Het
Hist1h2ac C T 13: 23,683,905 G5S probably damaging Het
Hyal4 A C 6: 24,765,862 Y405S possibly damaging Het
Ifi204 G A 1: 173,752,759 T395I probably damaging Het
Igsf9 A G 1: 172,498,438 E1147G probably damaging Het
Inpp5a T A 7: 139,538,181 I225N possibly damaging Het
Kcnv1 T C 15: 45,109,122 K455R probably damaging Het
Kmt2c T C 5: 25,310,457 D2796G probably benign Het
Ngp A T 9: 110,422,333 D143V probably benign Het
Nlrp5 T C 7: 23,418,839 C663R possibly damaging Het
Nup205 G T 6: 35,227,680 R1469L probably damaging Het
Nup205 T A 6: 35,230,548 F1512I probably damaging Het
Nwd1 T C 8: 72,670,914 S594P probably damaging Het
Nxpe2 A C 9: 48,319,575 V498G probably benign Het
P3h4 G A 11: 100,411,851 R320C probably damaging Het
Plec A G 15: 76,179,255 L2273P probably damaging Het
Ppp1r14b C T 19: 6,976,583 L100F probably damaging Het
Prlhr C T 19: 60,467,068 W353* probably null Het
Ralgps2 C T 1: 156,832,664 probably null Het
Rrp12 C T 19: 41,880,152 G584D possibly damaging Het
Scamp3 T C 3: 89,181,197 F237L probably damaging Het
Scn10a A G 9: 119,635,441 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shroom1 A T 11: 53,463,991 D246V probably benign Het
Snapc4 T A 2: 26,378,606 E14D probably damaging Het
Spag5 A T 11: 78,304,146 Q93L probably benign Het
Tle1 C T 4: 72,120,135 probably null Het
Ttll10 G A 4: 156,034,981 P683S possibly damaging Het
Unc13c A C 9: 73,812,367 D1006E probably benign Het
Unc80 A T 1: 66,693,796 K3101N possibly damaging Het
Vdac1 A G 11: 52,387,453 Y247C possibly damaging Het
Vmn2r1 G A 3: 64,090,053 V377I probably benign Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Xrcc3 C T 12: 111,804,610 R295Q probably damaging Het
Zfp780b T C 7: 27,964,818 N104S probably benign Het
Zkscan17 A G 11: 59,487,571 V262A possibly damaging Het
Other mutations in Ctsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ctsd APN 7 142382681 missense probably damaging 1.00
IGL01963:Ctsd APN 7 142376599 critical splice donor site probably null
IGL02021:Ctsd APN 7 142385476 missense probably damaging 0.99
twiggy UTSW 7 142377144 missense probably damaging 1.00
R5161:Ctsd UTSW 7 142377144 missense probably damaging 1.00
R5533:Ctsd UTSW 7 142377333 missense probably benign 0.00
R5933:Ctsd UTSW 7 142376579 missense probably benign 0.00
R6031:Ctsd UTSW 7 142376714 missense probably damaging 1.00
R6365:Ctsd UTSW 7 142385577 missense probably benign 0.37
R6721:Ctsd UTSW 7 142376853 missense possibly damaging 0.77
X0025:Ctsd UTSW 7 142376844 missense probably damaging 1.00
Z1088:Ctsd UTSW 7 142376597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAAAGGCCACTGAGCATG -3'
(R):5'- GCAATCTATTCTTGGGAGTCCC -3'

Sequencing Primer
(F):5'- CATGGCTGAGAGTGTAACATAGC -3'
(R):5'- GGAGTCCCTTTCCCTATTCGG -3'
Posted On2016-11-21