Incidental Mutation 'V8831:Bard1'
ID 44606
Institutional Source Beutler Lab
Gene Symbol Bard1
Ensembl Gene ENSMUSG00000026196
Gene Name BRCA1 associated RING domain 1
Synonyms ENSMUSG00000073653, ENSMUSG00000060893
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # V8831 () of strain 710
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 71066690-71142300 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71127376 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 78 (P78S)
Ref Sequence ENSEMBL: ENSMUSP00000027393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027393]
AlphaFold O70445
Predicted Effect probably damaging
Transcript: ENSMUST00000027393
AA Change: P78S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027393
Gene: ENSMUSG00000026196
AA Change: P78S

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
RING 44 80 3.71e-2 SMART
low complexity region 225 232 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
ANK 415 444 3.46e-4 SMART
ANK 448 477 8.32e-7 SMART
ANK 481 510 1.55e-6 SMART
BRCT 553 631 3.56e-10 SMART
BRCT 657 758 2.35e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions of this gene fail to develop past the egg cylinder stage. The phenotype is similar to that of mice with homozygous for disruptions in Brca1 or homozygous for disruptions in both Bard1 and Brca1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,316,697 (GRCm39) N107S probably damaging Het
Arhgap23 A G 11: 97,347,371 (GRCm39) I690V probably benign Het
Ccar1 G A 10: 62,583,185 (GRCm39) T976I unknown Het
Cdc7 T A 5: 107,116,776 (GRCm39) N50K probably benign Het
Cep85 C T 4: 133,883,380 (GRCm39) E170K possibly damaging Het
Cpsf2 C T 12: 101,969,400 (GRCm39) R757C probably damaging Het
Csmd3 A T 15: 48,321,092 (GRCm39) D239E probably damaging Het
Dnah7b T G 1: 46,412,458 (GRCm39) Y4022* probably null Het
Elmo3 A G 8: 106,033,693 (GRCm39) N179S probably benign Het
H2bc11 G C 13: 22,227,451 (GRCm39) probably benign Het
H2-T24 T A 17: 36,328,216 (GRCm39) Q89L probably damaging Het
Irak4 T C 15: 94,459,365 (GRCm39) I327T probably damaging Het
Itpr2 A T 6: 146,287,380 (GRCm39) L157Q probably damaging Het
Lama1 G A 17: 68,059,878 (GRCm39) D656N probably benign Het
Lrrc72 G T 12: 36,258,656 (GRCm39) T67K possibly damaging Het
Map2 T G 1: 66,455,004 (GRCm39) I1298S probably damaging Het
Mroh2a T TN 1: 88,183,889 (GRCm39) probably null Het
Ndst1 G A 18: 60,835,999 (GRCm39) A428V probably damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Or2w1b T C 13: 21,300,173 (GRCm39) Y104H possibly damaging Het
Or5k14 G T 16: 58,693,438 (GRCm39) T25K probably benign Het
Or5p4 C T 7: 107,680,742 (GRCm39) A247V probably benign Het
Plxna1 A G 6: 89,334,119 (GRCm39) V170A probably damaging Het
Rfx6 G A 10: 51,594,304 (GRCm39) probably null Het
Shprh G A 10: 11,062,606 (GRCm39) D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 (GRCm38) M179T probably benign Het
Slc9c1 A T 16: 45,398,262 (GRCm39) I676F possibly damaging Het
Smoc1 A G 12: 81,215,029 (GRCm39) D305G probably damaging Het
Spdef C T 17: 27,937,051 (GRCm39) R184H probably damaging Het
Stxbp4 C T 11: 90,371,497 (GRCm39) A535T probably benign Het
Tcp11l1 C G 2: 104,515,829 (GRCm39) V345L probably benign Het
Ticam1 TC T 17: 56,576,969 (GRCm39) 708 probably null Het
Ttc28 A T 5: 111,248,578 (GRCm39) Y177F probably benign Het
Ugt2b34 A T 5: 87,054,533 (GRCm39) Y83N probably benign Het
Vmn2r30 G A 7: 7,337,148 (GRCm39) R163C probably benign Het
Xirp1 T G 9: 120,016,907 (GRCm38) Q970P probably benign Het
Other mutations in Bard1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Bard1 APN 1 71,070,585 (GRCm39) missense probably benign 0.08
IGL02128:Bard1 APN 1 71,114,387 (GRCm39) missense possibly damaging 0.66
IGL02249:Bard1 APN 1 71,092,828 (GRCm39) missense probably damaging 1.00
IGL02552:Bard1 APN 1 71,104,815 (GRCm39) splice site probably benign
IGL02661:Bard1 APN 1 71,114,469 (GRCm39) missense probably damaging 1.00
IGL03087:Bard1 APN 1 71,106,289 (GRCm39) missense probably damaging 1.00
PIT4651001:Bard1 UTSW 1 71,114,087 (GRCm39) missense probably benign 0.00
R0096:Bard1 UTSW 1 71,092,889 (GRCm39) splice site probably benign
R0328:Bard1 UTSW 1 71,085,921 (GRCm39) missense probably benign 0.29
R0838:Bard1 UTSW 1 71,069,812 (GRCm39) missense probably damaging 1.00
R2007:Bard1 UTSW 1 71,070,562 (GRCm39) missense probably benign 0.00
R2055:Bard1 UTSW 1 71,114,031 (GRCm39) missense probably benign 0.00
R2110:Bard1 UTSW 1 71,114,550 (GRCm39) nonsense probably null
R2237:Bard1 UTSW 1 71,114,135 (GRCm39) missense probably damaging 1.00
R2416:Bard1 UTSW 1 71,113,811 (GRCm39) missense probably benign
R3054:Bard1 UTSW 1 71,127,390 (GRCm39) missense possibly damaging 0.77
R3055:Bard1 UTSW 1 71,127,390 (GRCm39) missense possibly damaging 0.77
R3056:Bard1 UTSW 1 71,127,390 (GRCm39) missense possibly damaging 0.77
R3871:Bard1 UTSW 1 71,114,099 (GRCm39) missense probably benign 0.05
R3905:Bard1 UTSW 1 71,106,339 (GRCm39) missense possibly damaging 0.70
R4117:Bard1 UTSW 1 71,085,922 (GRCm39) missense probably damaging 1.00
R4766:Bard1 UTSW 1 71,114,333 (GRCm39) missense probably benign 0.01
R5230:Bard1 UTSW 1 71,092,770 (GRCm39) critical splice donor site probably null
R5250:Bard1 UTSW 1 71,113,722 (GRCm39) missense probably damaging 1.00
R5531:Bard1 UTSW 1 71,085,880 (GRCm39) missense probably damaging 1.00
R5653:Bard1 UTSW 1 71,070,588 (GRCm39) missense probably benign
R6008:Bard1 UTSW 1 71,069,909 (GRCm39) missense possibly damaging 0.65
R7503:Bard1 UTSW 1 71,069,995 (GRCm39) missense probably damaging 1.00
R7543:Bard1 UTSW 1 71,114,589 (GRCm39) missense probably damaging 1.00
R7750:Bard1 UTSW 1 71,106,101 (GRCm39) splice site probably null
R8134:Bard1 UTSW 1 71,106,297 (GRCm39) missense probably damaging 1.00
R8714:Bard1 UTSW 1 71,069,986 (GRCm39) missense probably damaging 1.00
R9057:Bard1 UTSW 1 71,069,807 (GRCm39) missense probably damaging 1.00
R9534:Bard1 UTSW 1 71,114,189 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TATAGCAAGCAGCCAGTGCCAC -3'
(R):5'- TCAGAGCGCACCGTTTTACCAG -3'

Sequencing Primer
(F):5'- TCCCTGGACTGACATCAAGAG -3'
(R):5'- GCACCGTTTTACCAGTCTATG -3'
Posted On 2013-06-11