Incidental Mutation 'R5763:Tet1'
ID446130
Institutional Source Beutler Lab
Gene Symbol Tet1
Ensembl Gene ENSMUSG00000047146
Gene Nametet methylcytosine dioxygenase 1
SynonymsBB001228, 2510010B09Rik, D10Ertd17e, Cxxc6
MMRRC Submission 043364-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5763 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62804570-62908996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62840068 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 743 (N743I)
Ref Sequence ENSEMBL: ENSMUSP00000059527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174189]
Predicted Effect probably damaging
Transcript: ENSMUST00000050826
AA Change: N743I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: N743I

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.5e-11 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1931 1e-171 SMART
low complexity region 1944 1956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173081
Predicted Effect probably damaging
Transcript: ENSMUST00000174189
AA Change: N743I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: N743I

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.7e-10 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1963 7.36e-170 SMART
low complexity region 1976 1988 N/A INTRINSIC
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,743,031 H330R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Actl6b T A 5: 137,566,801 L314Q possibly damaging Het
Adam22 A T 5: 8,134,544 C483S probably damaging Het
Adamts7 T A 9: 90,188,409 L601H probably damaging Het
Agl A T 3: 116,753,360 D1280E probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Astn2 T A 4: 65,729,331 M757L probably benign Het
Atr A G 9: 95,945,123 M2407V probably benign Het
Brca2 T C 5: 150,548,006 F2283L possibly damaging Het
Brwd1 A T 16: 96,033,843 Y940* probably null Het
Camk2g A T 14: 20,739,347 N218K probably damaging Het
Ces2a C T 8: 104,736,124 P115L probably benign Het
Col11a1 T C 3: 114,094,596 probably benign Het
Col1a2 T A 6: 4,515,682 D150E unknown Het
Crybg3 A G 16: 59,554,610 S2094P possibly damaging Het
Cttnbp2 T C 6: 18,414,299 N916D probably benign Het
Ddx24 A G 12: 103,417,414 F593L probably damaging Het
Dhx16 G A 17: 35,881,688 E171K possibly damaging Het
Dnah5 T C 15: 28,311,152 I1759T probably damaging Het
Dnah9 C A 11: 65,955,239 S2991I probably damaging Het
Entpd7 G T 19: 43,704,266 V87L probably damaging Het
Fam221a T G 6: 49,378,584 L207V probably damaging Het
Foxm1 T A 6: 128,366,108 I135N probably benign Het
Gabpa C A 16: 84,860,409 Q391K possibly damaging Het
Gipr T A 7: 19,163,550 H111L probably damaging Het
Gm884 G A 11: 103,613,643 P324S probably damaging Het
Gmip A G 8: 69,817,851 D737G probably damaging Het
Herc6 T A 6: 57,662,887 N995K probably damaging Het
Ldha G A 7: 46,847,789 probably benign Het
Masp1 T C 16: 23,496,247 E88G probably damaging Het
Micalcl G A 7: 112,374,654 probably null Het
Mill1 T A 7: 18,245,662 V18E probably benign Het
Mrgpra3 A T 7: 47,589,607 C190* probably null Het
Nog C T 11: 89,301,465 V186M probably damaging Het
Nrxn2 T C 19: 6,531,339 F392L probably benign Het
Olfr1252 T A 2: 89,722,028 M28L probably benign Het
Olfr367-ps T C 2: 37,271,013 noncoding transcript Het
Olfr393 T A 11: 73,847,867 Q86L probably benign Het
Olfr530 T A 7: 140,373,655 probably null Het
Olfr746 T C 14: 50,654,068 I277T possibly damaging Het
Phyhd1 T A 2: 30,279,971 D158E probably damaging Het
Pik3r4 G T 9: 105,669,775 K917N probably benign Het
Pnma1 A G 12: 84,147,350 V193A possibly damaging Het
Podxl2 T C 6: 88,849,823 E167G probably damaging Het
Prss50 A T 9: 110,862,449 K82* probably null Het
Qsox1 A G 1: 155,779,879 S513P probably benign Het
Rheb A G 5: 24,807,787 V98A probably benign Het
Rhoj A G 12: 75,391,832 I131V probably benign Het
Rsph4a A T 10: 33,905,688 D178V probably damaging Het
Setd2 T G 9: 110,556,275 probably null Het
Siglecf A T 7: 43,356,320 K434* probably null Het
Slc14a1 T C 18: 78,116,414 Y88C probably benign Het
Snx15 T C 19: 6,122,110 E89G probably damaging Het
Son C T 16: 91,657,490 R1042C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Suz12 C A 11: 80,025,308 Y457* probably null Het
Tmc6 A G 11: 117,769,433 F660L possibly damaging Het
Tnpo1 A C 13: 98,859,937 I452S possibly damaging Het
Trav4-3 G T 14: 53,599,387 G103V probably damaging Het
Ubap2 T C 4: 41,195,809 K994E probably damaging Het
Vmn2r14 T C 5: 109,215,858 T731A possibly damaging Het
Vmn2r52 T A 7: 10,171,304 I203L probably benign Het
Zfp663 G T 2: 165,358,435 S75* probably null Het
Zik1 G T 7: 10,492,366 H25N probably benign Het
Other mutations in Tet1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Tet1 APN 10 62814497 missense probably damaging 1.00
IGL01079:Tet1 APN 10 62879473 missense probably damaging 0.99
IGL01109:Tet1 APN 10 62879774 missense probably benign
IGL01634:Tet1 APN 10 62878588 missense possibly damaging 0.94
IGL02003:Tet1 APN 10 62816400 missense possibly damaging 0.92
IGL02081:Tet1 APN 10 62813818 missense probably damaging 1.00
IGL02100:Tet1 APN 10 62812728 missense possibly damaging 0.92
IGL02228:Tet1 APN 10 62813734 missense probably damaging 0.99
IGL02524:Tet1 APN 10 62878646 missense probably damaging 1.00
IGL02539:Tet1 APN 10 62813019 missense possibly damaging 0.60
IGL02608:Tet1 APN 10 62879609 missense possibly damaging 0.82
IGL02608:Tet1 APN 10 62839087 missense probably damaging 1.00
IGL02702:Tet1 APN 10 62879752 missense possibly damaging 0.83
K7371:Tet1 UTSW 10 62879176 missense probably benign
R0166:Tet1 UTSW 10 62840279 missense probably benign 0.05
R0371:Tet1 UTSW 10 62878399 missense probably damaging 0.97
R0373:Tet1 UTSW 10 62878209 nonsense probably null
R0391:Tet1 UTSW 10 62814546 unclassified probably null
R0445:Tet1 UTSW 10 62879941 missense probably benign 0.08
R1016:Tet1 UTSW 10 62879950 missense probably benign
R1344:Tet1 UTSW 10 62814521 missense probably damaging 1.00
R1546:Tet1 UTSW 10 62812910 missense probably damaging 1.00
R1651:Tet1 UTSW 10 62879674 missense probably damaging 1.00
R1725:Tet1 UTSW 10 62814477 missense probably damaging 1.00
R1752:Tet1 UTSW 10 62812989 missense probably damaging 0.99
R1834:Tet1 UTSW 10 62813665 missense probably damaging 0.99
R1964:Tet1 UTSW 10 62812947 missense possibly damaging 0.86
R2239:Tet1 UTSW 10 62879734 missense probably benign 0.01
R2962:Tet1 UTSW 10 62814544 nonsense probably null
R3084:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3086:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3972:Tet1 UTSW 10 62813726 missense probably damaging 1.00
R4622:Tet1 UTSW 10 62819474 missense possibly damaging 0.92
R4674:Tet1 UTSW 10 62838848 missense probably damaging 0.97
R4687:Tet1 UTSW 10 62838791 missense probably benign 0.04
R4718:Tet1 UTSW 10 62813812 missense probably damaging 0.96
R4801:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4802:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4903:Tet1 UTSW 10 62822658 missense probably damaging 1.00
R5153:Tet1 UTSW 10 62878578 missense possibly damaging 0.85
R5193:Tet1 UTSW 10 62838247 missense probably benign 0.22
R5225:Tet1 UTSW 10 62838671 missense probably damaging 1.00
R5437:Tet1 UTSW 10 62814451 missense probably benign 0.01
R5465:Tet1 UTSW 10 62839777 missense probably benign
R5535:Tet1 UTSW 10 62832907 missense probably damaging 1.00
R5586:Tet1 UTSW 10 62878294 missense probably damaging 1.00
R5788:Tet1 UTSW 10 62839958 missense possibly damaging 0.70
R5818:Tet1 UTSW 10 62816408 missense possibly damaging 0.71
R5860:Tet1 UTSW 10 62812620 unclassified probably null
R5975:Tet1 UTSW 10 62879773 missense probably benign 0.37
R6041:Tet1 UTSW 10 62813373 missense probably damaging 0.98
R6092:Tet1 UTSW 10 62813715 missense probably benign 0.10
R6132:Tet1 UTSW 10 62813300 missense probably damaging 0.99
R6157:Tet1 UTSW 10 62839970 missense probably damaging 0.98
R6520:Tet1 UTSW 10 62880013 start codon destroyed probably null 0.53
R7210:Tet1 UTSW 10 62814501 missense probably null 0.95
R7223:Tet1 UTSW 10 62813671 missense possibly damaging 0.95
R7255:Tet1 UTSW 10 62822636 missense probably benign 0.15
R7323:Tet1 UTSW 10 62880039 start gained probably benign
R7472:Tet1 UTSW 10 62813350 missense possibly damaging 0.84
R7507:Tet1 UTSW 10 62832892 critical splice donor site probably null
R7522:Tet1 UTSW 10 62818983 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCCTTGAGATGATCACACTCCC -3'
(R):5'- GTTGGATTTGATCACACATCCCC -3'

Sequencing Primer
(F):5'- CCCAACGCCTTGCTAAAT -3'
(R):5'- CATCCCCTTGAAAATGTAAGGAAG -3'
Posted On2016-11-21