Incidental Mutation 'R5764:Jag1'
ID446161
Institutional Source Beutler Lab
Gene Symbol Jag1
Ensembl Gene ENSMUSG00000027276
Gene Namejagged 1
SynonymsABE2, Gsfabe2, Serrate-1, Htu, Ozz, Headturner
MMRRC Submission 043365-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5764 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location137081456-137116644 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137089247 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 655 (C655Y)
Ref Sequence ENSEMBL: ENSMUSP00000028735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028735]
Predicted Effect probably damaging
Transcript: ENSMUST00000028735
AA Change: C655Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028735
Gene: ENSMUSG00000027276
AA Change: C655Y

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:MNNL 31 109 2.8e-31 PFAM
DSL 167 229 1.85e-37 SMART
EGF 233 263 1.66e1 SMART
EGF 264 294 2.25e1 SMART
EGF_CA 296 334 4.42e-7 SMART
EGF 339 372 2.64e-5 SMART
EGF_CA 374 410 2.89e-11 SMART
EGF_CA 412 448 2.8e-9 SMART
EGF_CA 450 485 2.31e-10 SMART
EGF_CA 487 523 1.69e-12 SMART
EGF_CA 525 561 4.19e-8 SMART
EGF 577 627 2.16e-1 SMART
EGF_CA 629 665 2.56e-12 SMART
EGF_CA 667 703 6.91e-9 SMART
EGF 708 741 5.88e-3 SMART
EGF 747 780 9.62e-8 SMART
EGF_CA 782 818 3.59e-7 SMART
EGF_CA 820 856 3.81e-11 SMART
VWC 863 930 4.79e-16 SMART
transmembrane domain 1069 1091 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133640
Meta Mutation Damage Score 0.586 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit extensive hemorrhaging and die prior to embryonic day 11.5, while heterozygotes exhibit defects of the eye. Heterozygotes for missense mutations have inner ear abnormalities. Other mutant mice display abnormal head movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,541,574 V536I possibly damaging Het
Arap2 T C 5: 62,642,854 T1277A probably damaging Het
Cep85l A T 10: 53,348,994 D166E probably benign Het
Cope T C 8: 70,306,581 S125P probably damaging Het
Dzip3 A G 16: 48,927,361 probably benign Het
Endou G A 15: 97,714,607 R253C probably damaging Het
Entpd1 A T 19: 40,738,973 probably null Het
Fam160a1 A G 3: 85,665,865 Y926H probably damaging Het
Grk3 A G 5: 112,966,910 probably null Het
Hba-a2 T A 11: 32,297,156 probably null Het
Hecw1 C T 13: 14,322,509 V305I probably damaging Het
Hspg2 C A 4: 137,561,721 T3735K probably damaging Het
Htr4 G A 18: 62,437,542 A223T probably damaging Het
Iglv1 T C 16: 19,085,440 I7M unknown Het
Jmjd1c C T 10: 67,226,512 T1548I probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Klra6 T A 6: 130,022,729 Q92L possibly damaging Het
Lrp1 T C 10: 127,595,318 N325S probably benign Het
Ly75 C T 2: 60,318,439 R1182H probably benign Het
Map2 T C 1: 66,414,875 S975P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mpdz A G 4: 81,356,446 F180L probably benign Het
Myadm G A 7: 3,297,252 V177I possibly damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nup153 A G 13: 46,687,327 M255T probably damaging Het
Pgm2 C T 4: 99,964,846 A303V probably damaging Het
Pgr A T 9: 8,900,537 I24F probably benign Het
Pigq A T 17: 25,932,119 I412N probably damaging Het
Plod2 A G 9: 92,603,021 H525R probably damaging Het
Polq T G 16: 37,017,344 M206R probably damaging Het
Psap T A 10: 60,293,406 S100T probably benign Het
Psme4 G A 11: 30,772,364 probably benign Het
Serpina1d T A 12: 103,765,821 M260L probably benign Het
Serpinf2 A G 11: 75,437,404 L106P possibly damaging Het
Sumf1 C T 6: 108,118,463 probably benign Het
Tcp1 A G 17: 12,916,602 T13A probably benign Het
Tfap2a A C 13: 40,728,355 I185S possibly damaging Het
Tlr2 A C 3: 83,838,512 I88S probably damaging Het
Tmc4 A T 7: 3,672,023 F283L probably damaging Het
Tox4 T C 14: 52,285,820 V79A probably damaging Het
Trim10 A T 17: 36,870,181 E101D probably damaging Het
Troap T A 15: 99,075,419 I22N probably damaging Het
Unc13c C T 9: 73,533,903 probably null Het
Utp4 T G 8: 106,917,616 V529G possibly damaging Het
Zeb2 T C 2: 44,996,919 M664V possibly damaging Het
Zfp180 A G 7: 24,101,484 Y53C possibly damaging Het
Other mutations in Jag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Jag1 APN 2 137086032 critical splice acceptor site probably null
IGL00912:Jag1 APN 2 137115573 missense probably damaging 1.00
IGL01104:Jag1 APN 2 137084378 missense probably benign 0.40
IGL01529:Jag1 APN 2 137084977 missense probably damaging 0.99
IGL01578:Jag1 APN 2 137100051 splice site probably benign
IGL01720:Jag1 APN 2 137087103 missense probably damaging 1.00
IGL01809:Jag1 APN 2 137115484 missense probably damaging 1.00
IGL02402:Jag1 APN 2 137085938 missense possibly damaging 0.79
IGL02434:Jag1 APN 2 137087155 missense probably benign 0.01
IGL02543:Jag1 APN 2 137091947 splice site probably benign
IGL02650:Jag1 APN 2 137115585 missense possibly damaging 0.95
IGL03010:Jag1 APN 2 137093198 splice site probably benign
IGL03102:Jag1 APN 2 137084688 missense probably benign 0.00
Grenville UTSW 2 137087142 missense probably damaging 1.00
PIT4651001:Jag1 UTSW 2 137101697 missense probably damaging 1.00
R0227:Jag1 UTSW 2 137115618 missense probably benign
R0306:Jag1 UTSW 2 137085935 missense probably damaging 1.00
R0325:Jag1 UTSW 2 137095445 critical splice donor site probably null
R0594:Jag1 UTSW 2 137087080 missense probably damaging 0.99
R0838:Jag1 UTSW 2 137093278 missense probably damaging 0.98
R0879:Jag1 UTSW 2 137100081 missense possibly damaging 0.80
R0900:Jag1 UTSW 2 137090882 frame shift probably null
R0972:Jag1 UTSW 2 137083451 missense possibly damaging 0.64
R1083:Jag1 UTSW 2 137096232 missense probably damaging 0.99
R1182:Jag1 UTSW 2 137091489 missense probably benign 0.36
R1292:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1500:Jag1 UTSW 2 137115638 missense possibly damaging 0.82
R1936:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1937:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1939:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1998:Jag1 UTSW 2 137090938 missense probably damaging 1.00
R2019:Jag1 UTSW 2 137084679 missense probably benign 0.37
R2213:Jag1 UTSW 2 137089892 missense probably benign 0.01
R2300:Jag1 UTSW 2 137096315 missense probably damaging 1.00
R2484:Jag1 UTSW 2 137084700 missense possibly damaging 0.86
R4179:Jag1 UTSW 2 137101658 missense probably damaging 0.99
R4212:Jag1 UTSW 2 137085070 missense probably benign
R4630:Jag1 UTSW 2 137085979 missense probably damaging 1.00
R4701:Jag1 UTSW 2 137094456 missense probably benign 0.11
R4705:Jag1 UTSW 2 137096309 missense probably damaging 1.00
R4904:Jag1 UTSW 2 137087142 missense probably damaging 1.00
R5050:Jag1 UTSW 2 137085154 missense possibly damaging 0.71
R5288:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5367:Jag1 UTSW 2 137085094 missense possibly damaging 0.90
R5385:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5386:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5430:Jag1 UTSW 2 137101706 missense possibly damaging 0.94
R5472:Jag1 UTSW 2 137084995 missense probably damaging 1.00
R5755:Jag1 UTSW 2 137088690 missense probably damaging 1.00
R5804:Jag1 UTSW 2 137088204 missense probably benign 0.01
R6406:Jag1 UTSW 2 137087643 missense probably damaging 1.00
R6503:Jag1 UTSW 2 137101629 missense probably damaging 1.00
R6721:Jag1 UTSW 2 137094474 missense probably benign 0.00
R6826:Jag1 UTSW 2 137116175 critical splice donor site probably null
R7055:Jag1 UTSW 2 137115489 missense probably benign 0.26
Z1088:Jag1 UTSW 2 137085151 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCTGGAAAGAACCTAACTGC -3'
(R):5'- AGGCAGCTGTGACAATGAC -3'

Sequencing Primer
(F):5'- TATCATCCCCCAGTGGTGG -3'
(R):5'- CAGCTGTGACAATGACCAGGC -3'
Posted On2016-11-21