Incidental Mutation 'R5764:Troap'
ID446195
Institutional Source Beutler Lab
Gene Symbol Troap
Ensembl Gene ENSMUSG00000032783
Gene Nametrophinin associated protein
SynonymsE130301L11Rik, tastin
MMRRC Submission 043365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5764 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99074575-99083409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99075419 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 22 (I22N)
Ref Sequence ENSEMBL: ENSMUSP00000155404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039665] [ENSMUST00000230054]
Predicted Effect probably damaging
Transcript: ENSMUST00000039665
AA Change: I22N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035389
Gene: ENSMUSG00000032783
AA Change: I22N

DomainStartEndE-ValueType
low complexity region 232 246 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230027
Predicted Effect probably damaging
Transcript: ENSMUST00000230054
AA Change: I22N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230868
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,541,574 V536I possibly damaging Het
Arap2 T C 5: 62,642,854 T1277A probably damaging Het
Cep85l A T 10: 53,348,994 D166E probably benign Het
Cope T C 8: 70,306,581 S125P probably damaging Het
Dzip3 A G 16: 48,927,361 probably benign Het
Endou G A 15: 97,714,607 R253C probably damaging Het
Entpd1 A T 19: 40,738,973 probably null Het
Fam160a1 A G 3: 85,665,865 Y926H probably damaging Het
Grk3 A G 5: 112,966,910 probably null Het
Hba-a2 T A 11: 32,297,156 probably null Het
Hecw1 C T 13: 14,322,509 V305I probably damaging Het
Hspg2 C A 4: 137,561,721 T3735K probably damaging Het
Htr4 G A 18: 62,437,542 A223T probably damaging Het
Iglv1 T C 16: 19,085,440 I7M unknown Het
Jag1 C T 2: 137,089,247 C655Y probably damaging Het
Jmjd1c C T 10: 67,226,512 T1548I probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Klra6 T A 6: 130,022,729 Q92L possibly damaging Het
Lrp1 T C 10: 127,595,318 N325S probably benign Het
Ly75 C T 2: 60,318,439 R1182H probably benign Het
Map2 T C 1: 66,414,875 S975P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mpdz A G 4: 81,356,446 F180L probably benign Het
Myadm G A 7: 3,297,252 V177I possibly damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nup153 A G 13: 46,687,327 M255T probably damaging Het
Pgm2 C T 4: 99,964,846 A303V probably damaging Het
Pgr A T 9: 8,900,537 I24F probably benign Het
Pigq A T 17: 25,932,119 I412N probably damaging Het
Plod2 A G 9: 92,603,021 H525R probably damaging Het
Polq T G 16: 37,017,344 M206R probably damaging Het
Psap T A 10: 60,293,406 S100T probably benign Het
Psme4 G A 11: 30,772,364 probably benign Het
Serpina1d T A 12: 103,765,821 M260L probably benign Het
Serpinf2 A G 11: 75,437,404 L106P possibly damaging Het
Sumf1 C T 6: 108,118,463 probably benign Het
Tcp1 A G 17: 12,916,602 T13A probably benign Het
Tfap2a A C 13: 40,728,355 I185S possibly damaging Het
Tlr2 A C 3: 83,838,512 I88S probably damaging Het
Tmc4 A T 7: 3,672,023 F283L probably damaging Het
Tox4 T C 14: 52,285,820 V79A probably damaging Het
Trim10 A T 17: 36,870,181 E101D probably damaging Het
Unc13c C T 9: 73,533,903 probably null Het
Utp4 T G 8: 106,917,616 V529G possibly damaging Het
Zeb2 T C 2: 44,996,919 M664V possibly damaging Het
Zfp180 A G 7: 24,101,484 Y53C possibly damaging Het
Other mutations in Troap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Troap APN 15 99082146 missense probably damaging 1.00
IGL01949:Troap APN 15 99081221 missense probably benign 0.08
IGL02468:Troap APN 15 99075361 missense possibly damaging 0.83
IGL02804:Troap APN 15 99077671 splice site probably null
IGL03224:Troap APN 15 99081877 missense probably benign
R0617:Troap UTSW 15 99082660 missense probably damaging 1.00
R1085:Troap UTSW 15 99082163 missense probably damaging 0.99
R1872:Troap UTSW 15 99075352 splice site probably benign
R1884:Troap UTSW 15 99077898 missense probably benign 0.00
R1937:Troap UTSW 15 99077388 missense probably damaging 1.00
R2063:Troap UTSW 15 99082463 missense probably benign 0.00
R2065:Troap UTSW 15 99082463 missense probably benign 0.00
R2066:Troap UTSW 15 99082463 missense probably benign 0.00
R2068:Troap UTSW 15 99082463 missense probably benign 0.00
R2087:Troap UTSW 15 99078817 missense possibly damaging 0.84
R2159:Troap UTSW 15 99077586 missense probably damaging 0.96
R4282:Troap UTSW 15 99078832 missense probably benign
R5296:Troap UTSW 15 99078817 missense probably damaging 0.99
R5557:Troap UTSW 15 99075794 missense possibly damaging 0.92
R5652:Troap UTSW 15 99082264 missense probably benign 0.00
R6891:Troap UTSW 15 99082688 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CACATGGATTGGGACCAAGG -3'
(R):5'- GTTGACGTTGAGTACTGCGC -3'

Sequencing Primer
(F):5'- CCAAGGGGAAAGAATCAGGGATATC -3'
(R):5'- AGTACTGCGCGGTGGTTTC -3'
Posted On2016-11-21