Incidental Mutation 'R5765:Cntnap2'
ID446221
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Namecontactin associated protein-like 2
Synonyms5430425M22Rik, Caspr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R5765 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location45059357-47304213 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 46529815 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
Predicted Effect probably benign
Transcript: ENSMUST00000114641
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182751
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,153,240 probably benign Het
4833423E24Rik T G 2: 85,484,194 probably null Het
Abcf2 T C 5: 24,573,423 R246G probably damaging Het
Adamts19 G T 18: 59,052,582 C1176F probably damaging Het
Adh7 G A 3: 138,226,329 V235I probably benign Het
Caprin2 G C 6: 148,843,168 P701A probably damaging Het
Casp7 T C 19: 56,433,883 V110A possibly damaging Het
Cd1d2 A T 3: 86,987,242 M106L probably benign Het
Cpm A G 10: 117,671,733 I252V probably benign Het
Dnaaf2 A C 12: 69,192,853 I631M probably damaging Het
Doxl2 C T 6: 48,978,537 P694S probably damaging Het
Fam117b A G 1: 59,970,472 probably null Het
Fbxw22 T C 9: 109,384,996 M251V probably benign Het
Fignl1 T C 11: 11,802,011 probably null Het
Foxp1 G A 6: 99,015,462 L156F probably damaging Het
Gdap1 A T 1: 17,161,426 M332L probably benign Het
H2-M3 T C 17: 37,272,443 F265S probably damaging Het
Il1rl1 C T 1: 40,461,943 A493V probably benign Het
Iqce A G 5: 140,666,140 S359P probably damaging Het
Kif2b C T 11: 91,577,242 E72K probably benign Het
Luzp1 T C 4: 136,541,029 S188P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mocs2 A G 13: 114,826,156 probably null Het
Mtnr1b T C 9: 15,863,163 Y200C probably damaging Het
Nalcn C T 14: 123,464,726 V458I possibly damaging Het
Nbea C T 3: 56,005,298 V1023I probably benign Het
Nbeal1 T A 1: 60,291,847 V2205D probably damaging Het
Nfe2l3 A G 6: 51,457,246 D262G probably damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Pcdhac1 A T 18: 37,090,319 R62* probably null Het
Pcdhga1 A G 18: 37,663,661 T573A probably benign Het
Plin4 C T 17: 56,102,470 C1276Y possibly damaging Het
Ppp6r1 C A 7: 4,642,208 R220L possibly damaging Het
Ptprz1 T G 6: 23,000,236 V775G probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc17a6 A G 7: 51,625,501 T103A possibly damaging Het
Spock1 A T 13: 57,429,404 L404Q probably benign Het
Stradb C A 1: 58,992,744 H272N probably benign Het
Strn3 A G 12: 51,633,627 S397P probably benign Het
Synpo2l C T 14: 20,666,130 R126H possibly damaging Het
Tas2r104 A G 6: 131,685,273 Y158H probably benign Het
Tiparp T A 3: 65,531,350 I29N possibly damaging Het
Tnpo1 G A 13: 98,859,841 T484M probably benign Het
Tsc22d4 A G 5: 137,758,543 I78V probably benign Het
Ugt2b1 T C 5: 86,919,406 Y386C probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Vmn2r116 G A 17: 23,401,404 C704Y probably damaging Het
Vmn2r97 T A 17: 18,947,180 Y565* probably null Het
Zfand2b T A 1: 75,170,527 probably null Het
Zzef1 C T 11: 72,821,937 Q228* probably null Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 utr 5 prime probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.27
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGAAATGTCTGGGACCACAC -3'
(R):5'- TGCAGACGACCCTGTATCAC -3'

Sequencing Primer
(F):5'- TGGGACCACACAGAGCATGC -3'
(R):5'- ACTCCACAAATGTGCATTTTACC -3'
Posted On2016-11-21