Incidental Mutation 'R5768:Cand1'
ID446394
Institutional Source Beutler Lab
Gene Symbol Cand1
Ensembl Gene ENSMUSG00000020114
Gene Namecullin associated and neddylation disassociated 1
SynonymsD10Ertd516e, 2310038O07Rik, 6330512O03Rik
MMRRC Submission 043368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5768 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location119199255-119240055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119211005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 860 (V860A)
Ref Sequence ENSEMBL: ENSMUSP00000020315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020315]
Predicted Effect probably benign
Transcript: ENSMUST00000020315
AA Change: V860A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020315
Gene: ENSMUSG00000020114
AA Change: V860A

DomainStartEndE-ValueType
SCOP:d1qgra_ 53 994 4e-44 SMART
Pfam:TIP120 1040 1203 1.9e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149155
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of Cullin-RING ubiquitin ligases, which are in involved in ubiquitinylation of proteins degraded by the Ub proteasome system. The encoded protein binds to unneddylated cullin-RING box protein complexes and acts as an inhibitor of cullin neddylation and of Skp1, cullin, and F box ubiquitin ligase complex assembly and activity. In mammalian cell culture, this protein predominantly localizes to the cytoplasm. Knockdown of this gene in preadipocytes results in blocked adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 G A 5: 8,127,426 T561I probably benign Het
Akp3 T C 1: 87,127,122 I393T probably damaging Het
Atxn10 A T 15: 85,393,420 I363F probably benign Het
BC004004 A T 17: 29,282,735 S83C probably damaging Het
Bin1 T A 18: 32,426,211 probably null Het
Cacna1c A G 6: 118,697,680 I541T probably damaging Het
Ccdc69 T C 11: 55,055,030 N50S possibly damaging Het
Cd209d T A 8: 3,871,968 T235S probably benign Het
Cdhr3 G T 12: 33,046,686 T591K possibly damaging Het
Cherp C T 8: 72,463,113 D658N probably damaging Het
Clip4 T A 17: 71,806,499 probably null Het
Cryzl1 C T 16: 91,695,354 V195M probably damaging Het
Cst11 A T 2: 148,770,467 Y83* probably null Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Ddi2 A T 4: 141,685,590 L4M probably damaging Het
Dip2b C A 15: 100,157,945 P393T probably benign Het
Dnmt3a G A 12: 3,885,660 probably null Het
Elf5 C T 2: 103,449,022 S196L probably damaging Het
Eps15 C G 4: 109,363,176 probably null Het
Fra10ac1 T C 19: 38,207,286 E163G probably benign Het
Gc T C 5: 89,441,266 T213A probably damaging Het
Grpel1 A T 5: 36,465,159 probably benign Het
Gsdme G A 6: 50,219,300 Q377* probably null Het
Hira T C 16: 18,935,018 probably benign Het
Hsd11b1 T A 1: 193,240,246 I168F probably damaging Het
Htr6 G A 4: 139,061,704 R347W probably damaging Het
Ipp A C 4: 116,510,770 T67P probably damaging Het
Lrfn5 G A 12: 61,839,723 R99Q probably benign Het
Madd T A 2: 91,167,829 I649F probably damaging Het
Map2k7 T A 8: 4,245,757 D368E probably benign Het
Mppe1 T G 18: 67,225,818 T360P possibly damaging Het
Msi2 A G 11: 88,717,738 F2L probably damaging Het
Nectin3 T C 16: 46,458,817 Q266R probably damaging Het
Nfasc T C 1: 132,605,145 H691R probably benign Het
Olfr1222 T C 2: 89,125,449 E94G probably benign Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Papss2 G A 19: 32,660,719 probably null Het
Pi4ka T C 16: 17,354,872 K549E probably benign Het
Plekha6 A G 1: 133,280,378 T596A probably benign Het
Polr2f A G 15: 79,151,645 D117G probably damaging Het
Psd T C 19: 46,312,739 E381G possibly damaging Het
Rfx6 G A 10: 51,726,880 R831H probably damaging Het
Rpp25l A T 4: 41,712,649 L42Q probably damaging Het
Ryr3 T C 2: 112,753,097 M2810V probably benign Het
Sdk1 C A 5: 142,143,871 L1616I probably benign Het
Spock2 T A 10: 60,126,207 F215I probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tchh A T 3: 93,446,181 E976V unknown Het
Tgfbr3 T C 5: 107,149,895 E213G probably benign Het
Tmed1 T C 9: 21,509,323 D71G probably benign Het
Tmtc4 T A 14: 122,933,153 K527N possibly damaging Het
Zfhx2 T C 14: 55,074,365 T291A probably benign Het
Other mutations in Cand1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cand1 APN 10 119211135 missense probably benign 0.00
IGL00917:Cand1 APN 10 119210936 missense possibly damaging 0.87
IGL01383:Cand1 APN 10 119208167 missense probably damaging 0.96
IGL02016:Cand1 APN 10 119212568 missense probably damaging 0.98
IGL02271:Cand1 APN 10 119211721 missense probably damaging 1.00
IGL02282:Cand1 APN 10 119210709 missense probably benign 0.26
IGL02494:Cand1 APN 10 119213617 missense probably benign
IGL02527:Cand1 APN 10 119206807 missense probably damaging 1.00
IGL02675:Cand1 APN 10 119219697 missense probably damaging 0.99
IGL02796:Cand1 UTSW 10 119213638 missense probably damaging 1.00
R0114:Cand1 UTSW 10 119216522 missense probably benign
R0667:Cand1 UTSW 10 119216520 missense probably benign 0.00
R1589:Cand1 UTSW 10 119213566 missense probably damaging 0.97
R1591:Cand1 UTSW 10 119211869 missense possibly damaging 0.63
R1626:Cand1 UTSW 10 119210014 missense possibly damaging 0.46
R1771:Cand1 UTSW 10 119208306 missense probably benign 0.05
R1937:Cand1 UTSW 10 119203020 missense probably damaging 1.00
R1951:Cand1 UTSW 10 119208020 splice site probably benign
R1990:Cand1 UTSW 10 119210067 missense probably damaging 1.00
R3522:Cand1 UTSW 10 119239197 missense probably benign 0.01
R4207:Cand1 UTSW 10 119211845 missense probably damaging 1.00
R4209:Cand1 UTSW 10 119211558 missense probably benign 0.24
R4502:Cand1 UTSW 10 119216667 missense probably benign
R4791:Cand1 UTSW 10 119210702 missense probably benign 0.02
R4841:Cand1 UTSW 10 119213546 critical splice donor site probably null
R4842:Cand1 UTSW 10 119213546 critical splice donor site probably null
R5326:Cand1 UTSW 10 119212028 missense probably benign
R5606:Cand1 UTSW 10 119211454 missense possibly damaging 0.63
R5613:Cand1 UTSW 10 119215323 missense possibly damaging 0.93
R5884:Cand1 UTSW 10 119213765 missense possibly damaging 0.90
R6006:Cand1 UTSW 10 119210028 missense possibly damaging 0.83
R6062:Cand1 UTSW 10 119218010 missense possibly damaging 0.89
R6734:Cand1 UTSW 10 119211992 missense possibly damaging 0.67
R6838:Cand1 UTSW 10 119210030 missense probably benign 0.21
R7058:Cand1 UTSW 10 119211754 missense probably benign 0.00
R7342:Cand1 UTSW 10 119211787 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CACCGATGCAGAGCTAATGATC -3'
(R):5'- TGCTCTCACTCATAAGCAGTC -3'

Sequencing Primer
(F):5'- GATGCAGAGCTAATGATCTCCTTC -3'
(R):5'- ATTGCCAAATGTGTAGCTGCC -3'
Posted On2016-11-21