Incidental Mutation 'R5768:Dip2b'
ID446403
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R5768 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100157945 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 393 (P393T)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: P159T

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: P159T

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: P393T

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: P393T

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108971
AA Change: P159T

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: P159T

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230733
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 G A 5: 8,127,426 T561I probably benign Het
Akp3 T C 1: 87,127,122 I393T probably damaging Het
Atxn10 A T 15: 85,393,420 I363F probably benign Het
BC004004 A T 17: 29,282,735 S83C probably damaging Het
Bin1 T A 18: 32,426,211 probably null Het
Cacna1c A G 6: 118,697,680 I541T probably damaging Het
Cand1 A G 10: 119,211,005 V860A probably benign Het
Ccdc69 T C 11: 55,055,030 N50S possibly damaging Het
Cd209d T A 8: 3,871,968 T235S probably benign Het
Cdhr3 G T 12: 33,046,686 T591K possibly damaging Het
Cherp C T 8: 72,463,113 D658N probably damaging Het
Clip4 T A 17: 71,806,499 probably null Het
Cryzl1 C T 16: 91,695,354 V195M probably damaging Het
Cst11 A T 2: 148,770,467 Y83* probably null Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Ddi2 A T 4: 141,685,590 L4M probably damaging Het
Dnmt3a G A 12: 3,885,660 probably null Het
Elf5 C T 2: 103,449,022 S196L probably damaging Het
Eps15 C G 4: 109,363,176 probably null Het
Fra10ac1 T C 19: 38,207,286 E163G probably benign Het
Gc T C 5: 89,441,266 T213A probably damaging Het
Grpel1 A T 5: 36,465,159 probably benign Het
Gsdme G A 6: 50,219,300 Q377* probably null Het
Hira T C 16: 18,935,018 probably benign Het
Hsd11b1 T A 1: 193,240,246 I168F probably damaging Het
Htr6 G A 4: 139,061,704 R347W probably damaging Het
Ipp A C 4: 116,510,770 T67P probably damaging Het
Lrfn5 G A 12: 61,839,723 R99Q probably benign Het
Madd T A 2: 91,167,829 I649F probably damaging Het
Map2k7 T A 8: 4,245,757 D368E probably benign Het
Mppe1 T G 18: 67,225,818 T360P possibly damaging Het
Msi2 A G 11: 88,717,738 F2L probably damaging Het
Nectin3 T C 16: 46,458,817 Q266R probably damaging Het
Nfasc T C 1: 132,605,145 H691R probably benign Het
Olfr1222 T C 2: 89,125,449 E94G probably benign Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Papss2 G A 19: 32,660,719 probably null Het
Pi4ka T C 16: 17,354,872 K549E probably benign Het
Plekha6 A G 1: 133,280,378 T596A probably benign Het
Polr2f A G 15: 79,151,645 D117G probably damaging Het
Psd T C 19: 46,312,739 E381G possibly damaging Het
Rfx6 G A 10: 51,726,880 R831H probably damaging Het
Rpp25l A T 4: 41,712,649 L42Q probably damaging Het
Ryr3 T C 2: 112,753,097 M2810V probably benign Het
Sdk1 C A 5: 142,143,871 L1616I probably benign Het
Spock2 T A 10: 60,126,207 F215I probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tchh A T 3: 93,446,181 E976V unknown Het
Tgfbr3 T C 5: 107,149,895 E213G probably benign Het
Tmed1 T C 9: 21,509,323 D71G probably benign Het
Tmtc4 T A 14: 122,933,153 K527N possibly damaging Het
Zfhx2 T C 14: 55,074,365 T291A probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 unclassified probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 unclassified probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 unclassified probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTCAGCACAGCCGGTTG -3'
(R):5'- ACTGCTGTTGGAACTCTGTC -3'

Sequencing Primer
(F):5'- TGTGACAGCGAGCCTTTCAG -3'
(R):5'- CGACCATTTGTAACTCAAGGTCAGG -3'
Posted On2016-11-21