Incidental Mutation 'R5768:Psd'
ID446409
Institutional Source Beutler Lab
Gene Symbol Psd
Ensembl Gene ENSMUSG00000037126
Gene Namepleckstrin and Sec7 domain containing
SynonymsPsdl, Efa6a, Efa6, 1110007H17Rik
MMRRC Submission 043368-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5768 (G1)
Quality Score160
Status Validated
Chromosome19
Chromosomal Location46312087-46327156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46312739 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000153381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]
Predicted Effect probably benign
Transcript: ENSMUST00000041391
AA Change: E1012G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126
AA Change: E1012G

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073116
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096029
AA Change: E1013G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126
AA Change: E1013G

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111881
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224556
AA Change: E381G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000225323
AA Change: E1013G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226062
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 G A 5: 8,127,426 T561I probably benign Het
Akp3 T C 1: 87,127,122 I393T probably damaging Het
Atxn10 A T 15: 85,393,420 I363F probably benign Het
BC004004 A T 17: 29,282,735 S83C probably damaging Het
Bin1 T A 18: 32,426,211 probably null Het
Cacna1c A G 6: 118,697,680 I541T probably damaging Het
Cand1 A G 10: 119,211,005 V860A probably benign Het
Ccdc69 T C 11: 55,055,030 N50S possibly damaging Het
Cd209d T A 8: 3,871,968 T235S probably benign Het
Cdhr3 G T 12: 33,046,686 T591K possibly damaging Het
Cherp C T 8: 72,463,113 D658N probably damaging Het
Clip4 T A 17: 71,806,499 probably null Het
Cryzl1 C T 16: 91,695,354 V195M probably damaging Het
Cst11 A T 2: 148,770,467 Y83* probably null Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Ddi2 A T 4: 141,685,590 L4M probably damaging Het
Dip2b C A 15: 100,157,945 P393T probably benign Het
Dnmt3a G A 12: 3,885,660 probably null Het
Elf5 C T 2: 103,449,022 S196L probably damaging Het
Eps15 C G 4: 109,363,176 probably null Het
Fra10ac1 T C 19: 38,207,286 E163G probably benign Het
Gc T C 5: 89,441,266 T213A probably damaging Het
Grpel1 A T 5: 36,465,159 probably benign Het
Gsdme G A 6: 50,219,300 Q377* probably null Het
Hira T C 16: 18,935,018 probably benign Het
Hsd11b1 T A 1: 193,240,246 I168F probably damaging Het
Htr6 G A 4: 139,061,704 R347W probably damaging Het
Ipp A C 4: 116,510,770 T67P probably damaging Het
Lrfn5 G A 12: 61,839,723 R99Q probably benign Het
Madd T A 2: 91,167,829 I649F probably damaging Het
Map2k7 T A 8: 4,245,757 D368E probably benign Het
Mppe1 T G 18: 67,225,818 T360P possibly damaging Het
Msi2 A G 11: 88,717,738 F2L probably damaging Het
Nectin3 T C 16: 46,458,817 Q266R probably damaging Het
Nfasc T C 1: 132,605,145 H691R probably benign Het
Olfr1222 T C 2: 89,125,449 E94G probably benign Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Papss2 G A 19: 32,660,719 probably null Het
Pi4ka T C 16: 17,354,872 K549E probably benign Het
Plekha6 A G 1: 133,280,378 T596A probably benign Het
Polr2f A G 15: 79,151,645 D117G probably damaging Het
Rfx6 G A 10: 51,726,880 R831H probably damaging Het
Rpp25l A T 4: 41,712,649 L42Q probably damaging Het
Ryr3 T C 2: 112,753,097 M2810V probably benign Het
Sdk1 C A 5: 142,143,871 L1616I probably benign Het
Spock2 T A 10: 60,126,207 F215I probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tchh A T 3: 93,446,181 E976V unknown Het
Tgfbr3 T C 5: 107,149,895 E213G probably benign Het
Tmed1 T C 9: 21,509,323 D71G probably benign Het
Tmtc4 T A 14: 122,933,153 K527N possibly damaging Het
Zfhx2 T C 14: 55,074,365 T291A probably benign Het
Other mutations in Psd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Psd APN 19 46314747 missense possibly damaging 0.77
IGL01307:Psd APN 19 46314658 missense probably damaging 1.00
IGL02329:Psd APN 19 46319659 missense possibly damaging 0.66
IGL02423:Psd APN 19 46314504 missense possibly damaging 0.95
IGL02644:Psd APN 19 46323395 missense probably damaging 1.00
IGL02724:Psd APN 19 46319545 missense probably benign 0.04
IGL03117:Psd APN 19 46323122 unclassified probably benign
ANU05:Psd UTSW 19 46314747 missense possibly damaging 0.77
P0035:Psd UTSW 19 46320961 missense possibly damaging 0.56
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0403:Psd UTSW 19 46320972 unclassified probably benign
R0499:Psd UTSW 19 46322161 missense probably damaging 0.98
R0542:Psd UTSW 19 46314210 missense probably damaging 1.00
R0543:Psd UTSW 19 46319517 missense possibly damaging 0.62
R0894:Psd UTSW 19 46313441 missense probably damaging 1.00
R1449:Psd UTSW 19 46324811 missense probably damaging 0.99
R1586:Psd UTSW 19 46314798 missense probably damaging 0.98
R2096:Psd UTSW 19 46324649 unclassified probably null
R2504:Psd UTSW 19 46324913 missense possibly damaging 0.90
R2857:Psd UTSW 19 46324420 missense probably benign 0.00
R2863:Psd UTSW 19 46314762 missense probably damaging 0.97
R3897:Psd UTSW 19 46324585 missense possibly damaging 0.93
R3967:Psd UTSW 19 46324406 missense probably benign
R3970:Psd UTSW 19 46324406 missense probably benign
R4435:Psd UTSW 19 46314494 missense probably damaging 1.00
R4612:Psd UTSW 19 46313339 missense probably benign 0.15
R4940:Psd UTSW 19 46322417 missense probably damaging 1.00
R5055:Psd UTSW 19 46322468 missense probably benign 0.00
R5485:Psd UTSW 19 46316089 splice site probably null
R5775:Psd UTSW 19 46314772 nonsense probably null
R6057:Psd UTSW 19 46323314 missense possibly damaging 0.77
R6349:Psd UTSW 19 46313387 unclassified probably null
R6496:Psd UTSW 19 46320314 missense probably damaging 1.00
R6614:Psd UTSW 19 46313412 missense probably benign 0.11
R6820:Psd UTSW 19 46320844 missense probably damaging 1.00
R6849:Psd UTSW 19 46317746 missense probably damaging 0.97
R6860:Psd UTSW 19 46322419 missense probably damaging 1.00
R7286:Psd UTSW 19 46314801 missense probably damaging 0.98
R7326:Psd UTSW 19 46324454 missense probably benign 0.01
R7351:Psd UTSW 19 46322430 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAACTTGATCAGGCCTCCCC -3'
(R):5'- CAGCACTGCTTCGAGTCAAG -3'

Sequencing Primer
(F):5'- CATTATCACAAAAAGGGGGTCTCTG -3'
(R):5'- CACTGCTTCGAGTCAAGATGAAG -3'
Posted On2016-11-21