Incidental Mutation 'R0544:Mbd5'
ID44646
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Namemethyl-CpG binding domain protein 5
SynonymsC030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
MMRRC Submission 038736-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0544 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48949508-49325405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49257209 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 477 (V477A)
Ref Sequence ENSEMBL: ENSMUSP00000108374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112745] [ENSMUST00000112754]
Predicted Effect probably benign
Transcript: ENSMUST00000047413
AA Change: V477A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: V477A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112745
AA Change: V477A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108365
Gene: ENSMUSG00000036792
AA Change: V477A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 4e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112754
AA Change: V477A

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: V477A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122841
AA Change: V216A
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: V216A

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A T 14: 70,157,314 F130L probably benign Het
Aatf C T 11: 84,423,005 R511Q probably benign Het
Acot12 A T 13: 91,784,656 D516V probably benign Het
Adgrb2 T C 4: 130,017,542 V1207A probably damaging Het
Akap9 A G 5: 4,069,185 D3564G probably benign Het
Arl8b C T 6: 108,783,228 probably benign Het
Atf6b T C 17: 34,648,299 probably null Het
Atrn G A 2: 130,986,826 G1097D probably damaging Het
Btbd6 A G 12: 112,977,082 E61G probably damaging Het
Car15 A G 16: 17,835,816 probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Carmil2 C T 8: 105,691,235 A654V probably damaging Het
Cbwd1 A G 19: 24,949,211 Y159H possibly damaging Het
Ccdc88b A G 19: 6,857,266 L124P probably damaging Het
Ccnd1 A G 7: 144,937,286 probably benign Het
Cd3eap G T 7: 19,359,141 P38Q probably damaging Het
Cenph A G 13: 100,772,741 S53P probably damaging Het
Chrm3 T A 13: 9,877,579 I474F probably damaging Het
Cln8 T A 8: 14,896,769 V261E probably benign Het
Coa6 A G 8: 126,422,760 D25G probably benign Het
Col4a1 T G 8: 11,226,487 probably benign Het
Cpxm1 T C 2: 130,393,135 H588R probably damaging Het
Cul7 T C 17: 46,663,544 L1516P possibly damaging Het
Dcdc5 A G 2: 106,351,564 noncoding transcript Het
Ddx5 T C 11: 106,782,462 probably benign Het
Dhx16 C A 17: 35,881,659 P161Q probably benign Het
Dpy19l1 A T 9: 24,485,110 probably benign Het
Fastkd5 A G 2: 130,615,296 V458A probably damaging Het
Fhit A G 14: 9,870,172 V99A probably damaging Het
Fndc3a A T 14: 72,557,622 probably benign Het
Foxd4 A T 19: 24,899,818 S339R possibly damaging Het
Gm10842 T A 11: 105,147,054 D54E unknown Het
Gns T A 10: 121,376,267 Y94* probably null Het
Gp2 A G 7: 119,454,496 W81R probably benign Het
Hdac5 T G 11: 102,196,096 Q46P probably damaging Het
Homer2 A C 7: 81,649,678 V13G probably damaging Het
Irs3 A G 5: 137,643,839 S446P probably benign Het
Ism2 G T 12: 87,285,339 D141E probably damaging Het
Jak1 T A 4: 101,191,625 M19L probably benign Het
Kcnd3 C A 3: 105,658,759 R419S probably damaging Het
Lamb1 T C 12: 31,282,695 F272S probably damaging Het
Ldlrad2 T G 4: 137,572,268 T82P possibly damaging Het
Lrp2 T C 2: 69,491,931 K1885E probably benign Het
Mrps33 A T 6: 39,805,554 M11K possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myom2 T A 8: 15,069,796 V184E probably damaging Het
Ncor1 C A 11: 62,333,776 G1210V probably damaging Het
Ncor1 C T 11: 62,333,777 G1210R probably damaging Het
Nlrp4a A G 7: 26,457,130 D760G probably benign Het
Noc4l A G 5: 110,651,123 V231A possibly damaging Het
Olfr1056 T C 2: 86,355,663 T240A probably damaging Het
Olfr1217 T C 2: 89,023,826 Y59C probably damaging Het
Olfr1306 A T 2: 111,912,560 Y123* probably null Het
Olfr1450 A G 19: 12,953,702 T38A possibly damaging Het
Olfr193 T A 16: 59,110,225 K128N probably benign Het
Olfr521 T C 7: 99,767,660 I166T probably benign Het
Olfr598 T A 7: 103,328,651 I55N probably damaging Het
Olfr733 A T 14: 50,298,682 V209E probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Patj T A 4: 98,569,110 M1283K probably damaging Het
Pkd1 C T 17: 24,585,683 T790I probably damaging Het
Plod3 C A 5: 136,991,611 T526K probably benign Het
Plxnb2 C A 15: 89,158,613 probably benign Het
Pramel1 T A 4: 143,397,605 D283E possibly damaging Het
Prpf40a T C 2: 53,141,651 probably benign Het
Psg23 A T 7: 18,614,682 Y67N probably damaging Het
Rftn1 T A 17: 49,994,261 Q242L possibly damaging Het
Rp1l1 A T 14: 64,032,066 E1700D probably benign Het
Scube3 T C 17: 28,164,153 F435S probably damaging Het
Sdk2 T C 11: 113,781,010 Y2104C probably damaging Het
Sept11 A G 5: 93,165,368 E358G possibly damaging Het
Sh3bp1 T C 15: 78,905,775 L246P probably damaging Het
Sis T C 3: 72,951,642 Y352C probably damaging Het
Skint1 T C 4: 112,021,365 S165P probably damaging Het
Skint10 C T 4: 112,728,811 probably benign Het
Slc1a2 A T 2: 102,756,072 R340S probably damaging Het
Slc26a3 C A 12: 31,447,740 Q48K probably benign Het
Slc5a2 A T 7: 128,269,999 Y317F probably damaging Het
Sorbs3 T A 14: 70,193,926 T262S probably benign Het
Tas2r118 G T 6: 23,969,401 S220R probably damaging Het
Terf2ip C A 8: 112,015,342 Q223K possibly damaging Het
Tespa1 A G 10: 130,360,811 Q206R probably damaging Het
Tex10 T C 4: 48,462,766 probably null Het
Tle1 T A 4: 72,124,990 K547N probably damaging Het
Tmem131l T A 3: 83,898,546 Q1530L probably damaging Het
Tomm20l A G 12: 71,123,077 E145G possibly damaging Het
Tra2a C T 6: 49,250,951 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim37 T A 11: 87,145,502 Y121* probably null Het
Tube1 C T 10: 39,140,945 probably null Het
Usp6nl T A 2: 6,421,009 V187D probably damaging Het
Vmn1r13 T C 6: 57,210,263 F136L probably benign Het
Vmn1r201 A T 13: 22,475,146 I177F probably benign Het
Vmn1r203 A T 13: 22,524,273 T75S possibly damaging Het
Vmn1r225 C T 17: 20,502,456 S53L probably benign Het
Xab2 A T 8: 3,610,994 W707R probably damaging Het
Zfp808 T C 13: 62,169,434 probably benign Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0391:Mbd5 UTSW 2 49272416 missense possibly damaging 0.90
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0883:Mbd5 UTSW 2 49256689 missense possibly damaging 0.94
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R1710:Mbd5 UTSW 2 49257032 missense probably benign 0.10
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4366:Mbd5 UTSW 2 49272966 missense probably damaging 0.99
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4600:Mbd5 UTSW 2 49257197 missense probably benign 0.31
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R4846:Mbd5 UTSW 2 49256997 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5268:Mbd5 UTSW 2 49272094 missense possibly damaging 0.92
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5591:Mbd5 UTSW 2 49274669 missense probably damaging 1.00
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
R6935:Mbd5 UTSW 2 49279812 missense probably damaging 0.97
R7317:Mbd5 UTSW 2 49279743 missense probably benign
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCAAGTAATCTCCCTTTGCCAAC -3'
(R):5'- AACCATTTCCGGCAGGTGCAGTAG -3'

Sequencing Primer
(F):5'- TTGCCAACTGTAAAACCTGGTC -3'
(R):5'- TAGGAAAAGCTGCACTGCTTG -3'
Posted On2013-06-11