Incidental Mutation 'R5699:Col5a1'
ID446543
Institutional Source Beutler Lab
Gene Symbol Col5a1
Ensembl Gene ENSMUSG00000026837
Gene Namecollagen, type V, alpha 1
Synonyms
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location27886425-28039514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27997599 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 961 (G961R)
Ref Sequence ENSEMBL: ENSMUSP00000028280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028280]
Predicted Effect unknown
Transcript: ENSMUST00000028280
AA Change: G961R
SMART Domains Protein: ENSMUSP00000028280
Gene: ENSMUSG00000026837
AA Change: G961R

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
TSPN 39 230 5.7e-73 SMART
LamG 98 229 6.86e-3 SMART
low complexity region 259 288 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 374 387 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
internal_repeat_7 443 457 9.97e-7 PROSPERO
Pfam:Collagen 467 519 4e-10 PFAM
Pfam:Collagen 557 619 6.5e-9 PFAM
internal_repeat_2 622 642 1.83e-11 PROSPERO
low complexity region 643 698 N/A INTRINSIC
low complexity region 712 757 N/A INTRINSIC
low complexity region 760 793 N/A INTRINSIC
internal_repeat_5 794 817 3.78e-8 PROSPERO
internal_repeat_7 798 812 9.97e-7 PROSPERO
internal_repeat_8 802 821 8.84e-6 PROSPERO
low complexity region 826 862 N/A INTRINSIC
internal_repeat_3 865 889 2.79e-10 PROSPERO
internal_repeat_5 869 892 3.78e-8 PROSPERO
low complexity region 895 925 N/A INTRINSIC
internal_repeat_2 928 948 1.83e-11 PROSPERO
internal_repeat_4 928 948 1.27e-8 PROSPERO
low complexity region 949 979 N/A INTRINSIC
low complexity region 984 1033 N/A INTRINSIC
internal_repeat_4 1039 1062 1.27e-8 PROSPERO
internal_repeat_1 1039 1063 5.12e-15 PROSPERO
internal_repeat_3 1048 1072 2.79e-10 PROSPERO
internal_repeat_6 1049 1072 1.13e-7 PROSPERO
low complexity region 1075 1117 N/A INTRINSIC
low complexity region 1134 1165 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
internal_repeat_8 1195 1214 8.84e-6 PROSPERO
low complexity region 1215 1243 N/A INTRINSIC
low complexity region 1249 1282 N/A INTRINSIC
low complexity region 1285 1421 N/A INTRINSIC
internal_repeat_1 1423 1447 5.12e-15 PROSPERO
Pfam:Collagen 1460 1529 8.4e-9 PFAM
Pfam:Collagen 1513 1575 1.2e-9 PFAM
COLFI 1608 1837 3.33e-153 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. The encoded procollagen protein occurs commonly as the heterotrimer pro-alpha1(V)-pro-alpha1(V)-pro-alpha2(V). Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10-11 due to cardiovascular insufficiency and lack of collagen fibril formation. Heterozygotes exhibit poorly organized and less dense fibers in the dermis and reduced skin tensile strength and are a model for Ehlers-Danlos Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Col5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Col5a1 APN 2 27971444 splice site probably benign
IGL01340:Col5a1 APN 2 27960451 missense unknown
IGL01938:Col5a1 APN 2 27996873 missense unknown
IGL02167:Col5a1 APN 2 28018556 missense probably benign
IGL02670:Col5a1 APN 2 27974715 missense unknown
IGL02672:Col5a1 APN 2 27974715 missense unknown
IGL02673:Col5a1 APN 2 27974715 missense unknown
IGL02832:Col5a1 APN 2 27952340 missense unknown
IGL03065:Col5a1 APN 2 28032745 missense possibly damaging 0.61
IGL03196:Col5a1 APN 2 27975598 missense unknown
PIT4131001:Col5a1 UTSW 2 28024653 missense probably benign 0.01
PIT4495001:Col5a1 UTSW 2 28024776 missense unknown
R0136:Col5a1 UTSW 2 28024831 missense probably damaging 1.00
R0485:Col5a1 UTSW 2 27990097 splice site probably benign
R0626:Col5a1 UTSW 2 27928243 nonsense probably null
R0666:Col5a1 UTSW 2 28032685 missense probably damaging 1.00
R1268:Col5a1 UTSW 2 28002489 missense unknown
R1302:Col5a1 UTSW 2 28005236 missense probably damaging 1.00
R1416:Col5a1 UTSW 2 27922064 missense unknown
R1466:Col5a1 UTSW 2 28003846 splice site probably benign
R1617:Col5a1 UTSW 2 27952381 missense unknown
R1650:Col5a1 UTSW 2 27922159 missense unknown
R1663:Col5a1 UTSW 2 27951476 missense unknown
R1901:Col5a1 UTSW 2 27960444 missense unknown
R1970:Col5a1 UTSW 2 27986754 missense unknown
R2377:Col5a1 UTSW 2 27928177 missense unknown
R2396:Col5a1 UTSW 2 27986729 missense unknown
R4297:Col5a1 UTSW 2 28017204 critical splice donor site probably null
R4385:Col5a1 UTSW 2 28024779 missense probably damaging 1.00
R4803:Col5a1 UTSW 2 28011341 missense unknown
R4835:Col5a1 UTSW 2 28025644 missense probably damaging 1.00
R4935:Col5a1 UTSW 2 28024742 missense probably damaging 1.00
R4994:Col5a1 UTSW 2 28032739 missense possibly damaging 0.90
R4997:Col5a1 UTSW 2 28032782 nonsense probably null
R5061:Col5a1 UTSW 2 27952378 missense unknown
R5088:Col5a1 UTSW 2 28018602 nonsense probably null
R5089:Col5a1 UTSW 2 28018602 nonsense probably null
R5090:Col5a1 UTSW 2 28018602 nonsense probably null
R5114:Col5a1 UTSW 2 28025652 missense probably damaging 1.00
R5409:Col5a1 UTSW 2 27960445 missense unknown
R5649:Col5a1 UTSW 2 27951456 missense unknown
R5910:Col5a1 UTSW 2 28036888 missense possibly damaging 0.89
R6053:Col5a1 UTSW 2 28014377 unclassified probably benign
R6210:Col5a1 UTSW 2 28032621 missense probably benign 0.04
R6363:Col5a1 UTSW 2 27928195 missense unknown
R6478:Col5a1 UTSW 2 27952436 missense unknown
R6600:Col5a1 UTSW 2 27997571 missense unknown
R7047:Col5a1 UTSW 2 27928084 missense unknown
R7061:Col5a1 UTSW 2 28025678 nonsense probably null
R7131:Col5a1 UTSW 2 27929486 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCCAACAGATTTCCTATCG -3'
(R):5'- AGCCTTAGCAGCTGGGTTTC -3'

Sequencing Primer
(F):5'- ATCGAGGAATCTGCCTATCTATCGG -3'
(R):5'- AGCAGCTGGGTTTCAGAGG -3'
Posted On2016-11-21