Incidental Mutation 'R5699:Grid2'
ID446563
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Nameglutamate receptor, ionotropic, delta 2
SynonymsGluRdelta2, tpr, B230104L07Rik
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5699 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location63255876-64704323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63908991 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 124 (A124T)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
Predicted Effect probably damaging
Transcript: ENSMUST00000095852
AA Change: A124T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: A124T

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159561
SMART Domains Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161105
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Disp1 TTGA T 1: 183,088,555 probably null Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably null
swagger UTSW 6 64395280 synonymous probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63931015 missense probably benign 0.01
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
R6999:Grid2 UTSW 6 64076909 missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64700418 missense unknown
R7126:Grid2 UTSW 6 64076810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTGCTTCTCAGAAAGGTGAAATC -3'
(R):5'- GCTTCTCATGCAAACGTTACC -3'

Sequencing Primer
(F):5'- TCATACAAAACTCACTTATCTTGGC -3'
(R):5'- CCTTATGAAACTCTTCAGATGGC -3'
Posted On2016-11-21