Incidental Mutation 'R5002:Tesk1'
ID446618
Institutional Source Beutler Lab
Gene Symbol Tesk1
Ensembl Gene ENSMUSG00000028458
Gene Nametestis specific protein kinase 1
Synonyms
MMRRC Submission 042596-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R5002 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43441939-43448064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43444573 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 126 (Y126H)
Ref Sequence ENSEMBL: ENSMUSP00000121067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030179] [ENSMUST00000060864] [ENSMUST00000098104] [ENSMUST00000098105] [ENSMUST00000107925] [ENSMUST00000107926] [ENSMUST00000138981]
Predicted Effect probably benign
Transcript: ENSMUST00000030179
SMART Domains Protein: ENSMUSP00000030179
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 348 2.28e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060864
AA Change: Y126H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050087
Gene: ENSMUSG00000028458
AA Change: Y126H

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 306 5.4e-46 PFAM
Pfam:Pkinase_Tyr 52 306 3.1e-47 PFAM
low complexity region 316 330 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 403 424 N/A INTRINSIC
low complexity region 472 490 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098104
SMART Domains Protein: ENSMUSP00000095708
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
coiled coil region 83 169 N/A INTRINSIC
CLECT 178 287 2.48e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098105
SMART Domains Protein: ENSMUSP00000095709
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 113 199 N/A INTRINSIC
CLECT 208 324 2.28e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107925
SMART Domains Protein: ENSMUSP00000103558
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 334 2.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107926
SMART Domains Protein: ENSMUSP00000103559
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 341 2.48e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137178
Predicted Effect probably damaging
Transcript: ENSMUST00000138981
AA Change: Y126H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121067
Gene: ENSMUSG00000028458
AA Change: Y126H

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 174 7.6e-29 PFAM
Pfam:Pkinase_Tyr 52 175 1.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156810
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain and a C-terminal proline-rich domain. Its protein kinase domain is most closely related to those of the LIM motif-containing protein kinases (LIMKs). The encoded protein can phosphorylate myelin basic protein and histone in vitro. The testicular germ cell-specific expression and developmental pattern of expression of the mouse gene suggests that this gene plays an important role at and after the meiotic phase of spermatogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G C 10: 22,067,817 P88R probably damaging Het
Abca8b G A 11: 109,961,797 P736S probably damaging Het
Apbb2 A G 5: 66,313,325 I523T possibly damaging Het
Casq1 T A 1: 172,213,378 D281V possibly damaging Het
Catsperb T C 12: 101,520,554 F447L probably benign Het
Cenpe A T 3: 135,247,081 M1511L probably benign Het
Cep128 T C 12: 91,255,723 probably null Het
Col6a6 T C 9: 105,786,093 T82A probably benign Het
Dna2 A G 10: 62,950,842 D123G probably damaging Het
Ergic2 A G 6: 148,184,158 I281T probably benign Het
Fcgbp T A 7: 28,086,103 probably null Het
Filip1l T C 16: 57,571,103 Y447H probably benign Het
Flnb T A 14: 7,945,882 M2429K probably damaging Het
Fn1 T A 1: 71,629,728 Q686L possibly damaging Het
Gm10644 T C 8: 83,933,587 D43G possibly damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm7534 T A 4: 134,196,920 N438I probably benign Het
Gpx6 A G 13: 21,313,688 Y43C probably damaging Het
Hhat A T 1: 192,543,190 F494I probably benign Het
Itga9 C A 9: 118,663,898 S287* probably null Het
Lrrk1 C A 7: 66,332,363 G177W probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Ms4a14 T C 19: 11,304,289 I302V probably benign Het
Nepn A C 10: 52,391,754 M39L probably benign Het
Nfil3 C A 13: 52,968,676 R64L probably damaging Het
Ociad1 T C 5: 73,310,316 V199A possibly damaging Het
Olfr1087 C A 2: 86,690,085 V297L possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Polk A G 13: 96,489,244 Y431H probably damaging Het
Prss33 C T 17: 23,835,358 probably benign Het
Slc12a7 A G 13: 73,763,777 N4S possibly damaging Het
Slc29a4 A T 5: 142,718,746 I348F probably damaging Het
Smarce1 T C 11: 99,225,063 N44S probably damaging Het
Spast C T 17: 74,369,226 Q344* probably null Het
Stk11ip C A 1: 75,532,543 probably benign Het
Tas2r131 T C 6: 132,957,151 I232V probably benign Het
Tmpo A G 10: 91,164,114 V164A possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vwc2l T G 1: 70,729,046 C43G probably damaging Het
Wnk1 G A 6: 119,937,963 T1626I probably benign Het
Other mutations in Tesk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Tesk1 APN 4 43445820 critical splice donor site probably null
IGL02969:Tesk1 APN 4 43447027 missense possibly damaging 0.49
IGL02969:Tesk1 APN 4 43447026 nonsense probably null
FR4449:Tesk1 UTSW 4 43447002 utr 3 prime probably benign
FR4737:Tesk1 UTSW 4 43447004 frame shift probably null
R0009:Tesk1 UTSW 4 43445368 missense probably damaging 0.99
R0396:Tesk1 UTSW 4 43446000 missense probably damaging 0.99
R0765:Tesk1 UTSW 4 43446706 missense possibly damaging 0.81
R1850:Tesk1 UTSW 4 43443576 missense probably damaging 1.00
R1868:Tesk1 UTSW 4 43447201 missense probably damaging 0.99
R1903:Tesk1 UTSW 4 43446998 missense probably benign 0.00
R3961:Tesk1 UTSW 4 43445133 splice site probably null
R3973:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3975:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3976:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R4074:Tesk1 UTSW 4 43443606 missense possibly damaging 0.88
R4908:Tesk1 UTSW 4 43445555 nonsense probably null
R5237:Tesk1 UTSW 4 43447100 missense probably damaging 0.98
R6755:Tesk1 UTSW 4 43445991 missense probably benign 0.03
R6886:Tesk1 UTSW 4 43443592 missense possibly damaging 0.72
R6991:Tesk1 UTSW 4 43447006 missense probably benign
R6992:Tesk1 UTSW 4 43447006 missense probably benign
R6993:Tesk1 UTSW 4 43447006 missense probably benign
X0064:Tesk1 UTSW 4 43443534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTACATAGTCCTACTGTGAGAG -3'
(R):5'- ATGTCAATATCCACAGGCCAATTAC -3'

Sequencing Primer
(F):5'- GACAGGGTAGCCTAGTATATAAATGG -3'
(R):5'- AGTCACAAACCCTCTTTAATCGTTC -3'
Posted On2016-11-23