Incidental Mutation 'R4970:Card10'
ID446623
Institutional Source Beutler Lab
Gene Symbol Card10
Ensembl Gene ENSMUSG00000033170
Gene Namecaspase recruitment domain family, member 10
SynonymsBimp1, CARMA3
MMRRC Submission 042565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4970 (G1)
Quality Score79
Status Validated
Chromosome15
Chromosomal Location78775138-78803042 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 78802380 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164826] [ENSMUST00000170584]
Predicted Effect probably null
Transcript: ENSMUST00000164826
SMART Domains Protein: ENSMUSP00000129513
Gene: ENSMUSG00000033170

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
Pfam:CARD 77 163 1.1e-22 PFAM
coiled coil region 188 498 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
low complexity region 607 614 N/A INTRINSIC
low complexity region 692 706 N/A INTRINSIC
PDB:3SHW|A 744 1055 1e-7 PDB
Blast:SH3 747 812 8e-8 BLAST
Blast:GuKc 883 1045 1e-19 BLAST
low complexity region 1057 1068 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170584
SMART Domains Protein: ENSMUSP00000131003
Gene: ENSMUSG00000033170

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:CARD 28 114 5.6e-23 PFAM
coiled coil region 139 449 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
low complexity region 558 565 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
PDB:3SHW|A 695 1006 1e-7 PDB
Blast:SH3 698 763 7e-8 BLAST
Blast:GuKc 834 996 1e-19 BLAST
low complexity region 1008 1019 N/A INTRINSIC
Meta Mutation Damage Score 0.708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The caspase recruitment domain (CARD) is a protein module that consists of 6 or 7 antiparallel alpha helices. It participates in apoptosis signaling through highly specific protein-protein homophilic interactions. Like several other CARD proteins, CARD10 belongs to the membrane-associated guanylate kinase (MAGUK) family and activates NF-kappa-B (NFKB; see MIM 164011) through BCL10 (MIM 603517) (Wang et al., 2001 [PubMed 11259443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit partial penetrance of anencephaly and subsequent perinatal lethality of anencephalic embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,065 noncoding transcript Het
Aars A G 8: 111,043,679 M370V probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acad9 A T 3: 36,085,525 I425F probably damaging Het
Adhfe1 C A 1: 9,558,238 D278E possibly damaging Het
Afg3l1 G A 8: 123,498,653 V532I probably benign Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Asah1 G T 8: 41,360,277 S33* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Bag4 A T 8: 25,771,244 Y156* probably null Het
Bmpr1b T C 3: 141,845,187 E381G probably damaging Het
Btnl7-ps A G 17: 34,537,118 noncoding transcript Het
Caap1 A T 4: 94,521,060 probably null Het
Ccp110 T C 7: 118,722,391 V423A possibly damaging Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Cfap57 A G 4: 118,620,371 F12S probably damaging Het
Clvs1 A G 4: 9,350,857 probably benign Het
Dgkh A T 14: 78,618,637 V199E probably damaging Het
Dhx32 T A 7: 133,738,655 probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Efcab7 C A 4: 99,831,543 S87R probably damaging Het
Fam81a G A 9: 70,093,590 Q291* probably null Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gm10313 A T 8: 46,255,425 noncoding transcript Het
Gm1966 A T 7: 106,600,657 noncoding transcript Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm5535 T A 2: 144,174,649 noncoding transcript Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Igfbp7 A G 5: 77,407,761 M85T possibly damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Itch T C 2: 155,185,593 F379L possibly damaging Het
Itgad T A 7: 128,189,843 V488D possibly damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Kirrel3 A G 9: 34,944,439 E92G possibly damaging Het
Lpin2 T C 17: 71,231,334 V325A probably damaging Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1 A C 10: 127,539,520 L4435R probably benign Het
Lrrn1 A G 6: 107,569,344 D701G probably benign Het
Map4k3 A T 17: 80,653,903 Y125N probably benign Het
Mau2 A T 8: 70,027,703 H273Q possibly damaging Het
Med16 A C 10: 79,907,037 probably null Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr619 T C 7: 103,603,990 I112T probably damaging Het
Olfr711 T A 7: 106,971,571 M258L probably benign Het
Olfr937 A T 9: 39,060,531 M45K probably benign Het
Pcdhb20 T A 18: 37,506,771 N783K probably benign Het
Pclo T A 5: 14,677,882 probably benign Het
Pdyn T A 2: 129,688,101 D216V probably damaging Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Polrmt G T 10: 79,736,587 H1145N probably damaging Het
Proser1 A G 3: 53,464,306 D11G probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Ptprn2 G A 12: 117,276,595 E991K probably damaging Het
Pwp2 A C 10: 78,173,693 L797R possibly damaging Het
Rbm20 G A 19: 53,851,669 A1030T probably damaging Het
Rdh7 T C 10: 127,885,822 Y195C probably benign Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Senp8 A C 9: 59,737,221 D204E probably benign Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sh2b1 T A 7: 126,468,803 R560W probably damaging Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a9 A T 4: 117,856,008 Y60F probably damaging Het
Slfn10-ps C T 11: 83,030,381 noncoding transcript Het
Spata31d1d G A 13: 59,727,520 H734Y probably benign Het
Spsb1 T A 4: 149,907,155 probably benign Het
Sptbn5 T A 2: 120,051,777 noncoding transcript Het
Sugp2 G A 8: 70,259,812 V1026I possibly damaging Het
Syt14 T A 1: 192,930,977 probably benign Het
Sytl1 G A 4: 133,255,582 Q373* probably null Het
Tex43 G T 18: 56,592,422 M46I possibly damaging Het
Trim38 T A 13: 23,791,329 L417Q probably damaging Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn1r225 G A 17: 20,502,569 G91S possibly damaging Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Wnk1 A T 6: 119,965,735 probably benign Het
Zfp239 A G 6: 117,870,517 probably benign Het
Zfp688 T C 7: 127,419,155 Y266C probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Zscan29 T C 2: 121,169,195 probably null Het
Other mutations in Card10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Card10 APN 15 78778215 missense probably damaging 1.00
IGL02804:Card10 APN 15 78802449 missense probably damaging 1.00
PIT4366001:Card10 UTSW 15 78787431 missense probably benign 0.14
R0529:Card10 UTSW 15 78780475 critical splice donor site probably null
R0571:Card10 UTSW 15 78787401 missense possibly damaging 0.88
R1118:Card10 UTSW 15 78802443 missense possibly damaging 0.90
R1444:Card10 UTSW 15 78787841 splice site probably benign
R1632:Card10 UTSW 15 78791220 nonsense probably null
R1669:Card10 UTSW 15 78793953 missense probably benign 0.20
R1862:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1863:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1997:Card10 UTSW 15 78793975 missense probably damaging 0.99
R2046:Card10 UTSW 15 78787473 missense possibly damaging 0.91
R2084:Card10 UTSW 15 78792971 missense possibly damaging 0.81
R2509:Card10 UTSW 15 78780273 missense probably benign 0.00
R2511:Card10 UTSW 15 78780273 missense probably benign 0.00
R4274:Card10 UTSW 15 78780514 missense probably damaging 1.00
R4887:Card10 UTSW 15 78781524 missense possibly damaging 0.66
R5098:Card10 UTSW 15 78776717 missense probably benign 0.37
R5112:Card10 UTSW 15 78802380 critical splice donor site probably null
R5243:Card10 UTSW 15 78780672 missense possibly damaging 0.70
R5256:Card10 UTSW 15 78778251 missense probably damaging 0.98
R5985:Card10 UTSW 15 78791211 missense probably benign 0.01
R6089:Card10 UTSW 15 78802414 missense probably benign 0.02
R6357:Card10 UTSW 15 78799379 missense probably damaging 1.00
R6545:Card10 UTSW 15 78776810 missense probably damaging 1.00
R6865:Card10 UTSW 15 78802622 missense possibly damaging 0.70
R6907:Card10 UTSW 15 78787471 missense possibly damaging 0.82
R6920:Card10 UTSW 15 78802409 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCGGATTTGAGCTCTTGAG -3'
(R):5'- TTGGGATCCCGGGAAGACG -3'

Sequencing Primer
(F):5'- CCCGGATTTGAGCTCTTGAGAAAAAC -3'
(R):5'- GTGCCCACCGTGCTTGTC -3'
Posted On2016-11-30