Incidental Mutation 'R4964:Zfp451'
ID446633
Institutional Source Beutler Lab
Gene Symbol Zfp451
Ensembl Gene ENSMUSG00000042197
Gene Namezinc finger protein 451
Synonyms4930515K21Rik, Kiaa0576-hp, 4933435G09Rik
MMRRC Submission 042561-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R4964 (G1)
Quality Score171
Status Validated
Chromosome1
Chromosomal Location33761545-33814595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33777861 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 119 (V119D)
Ref Sequence ENSEMBL: ENSMUSP00000110821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019861] [ENSMUST00000115167] [ENSMUST00000139143] [ENSMUST00000151055] [ENSMUST00000194656]
Predicted Effect probably damaging
Transcript: ENSMUST00000019861
AA Change: V336D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019861
Gene: ENSMUSG00000042197
AA Change: V336D

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115167
AA Change: V119D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110821
Gene: ENSMUSG00000042197
AA Change: V119D

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130376
SMART Domains Protein: ENSMUSP00000118047
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
ZnF_C2H2 30 56 1.63e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139143
Predicted Effect probably benign
Transcript: ENSMUST00000151055
Predicted Effect probably benign
Transcript: ENSMUST00000194656
SMART Domains Protein: ENSMUSP00000141813
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
ZnF_C2H2 127 153 6.9e-2 SMART
ZnF_C2H2 170 190 5e-1 SMART
ZnF_C2H2 211 235 7.2e-3 SMART
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 98% (100/102)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,474,221 probably benign Het
9030619P08Rik T A 15: 75,431,418 noncoding transcript Het
9030624J02Rik T C 7: 118,780,268 I426T possibly damaging Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abcb1b A T 5: 8,812,671 T118S probably benign Het
Abcb1b T A 5: 8,861,602 I133N probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Ankmy2 A G 12: 36,186,918 K242E possibly damaging Het
Apc2 A C 10: 80,314,007 I1603L probably benign Het
Arhgef25 T A 10: 127,185,603 I249F probably damaging Het
Birc3 T C 9: 7,860,552 H255R probably benign Het
Cables1 A T 18: 11,941,277 R486W possibly damaging Het
Caskin1 A T 17: 24,507,161 D1414V probably damaging Het
Ccdc175 A G 12: 72,180,845 S55P probably damaging Het
Ccdc57 A T 11: 120,861,152 S868T probably benign Het
Ccny A T 18: 9,449,516 probably null Het
Cdc34b A T 11: 94,742,261 I96F probably damaging Het
Ctnnd1 A G 2: 84,622,073 F69L possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Cyb5rl A G 4: 107,069,132 probably benign Het
Ddx18 T C 1: 121,566,094 K54E probably benign Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dlg1 C T 16: 31,754,808 T9I probably benign Het
Dnase1 T C 16: 4,037,907 probably benign Het
Drd4 T C 7: 141,293,777 M114T probably damaging Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Eif2s1 T A 12: 78,880,011 N178K probably benign Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
Galntl6 T C 8: 58,699,911 probably benign Het
Glipr1l2 T A 10: 112,106,999 I253K possibly damaging Het
Gnat1 A T 9: 107,677,234 M115K probably benign Het
Gtsf2 T C 15: 103,444,328 E88G possibly damaging Het
Hormad1 T A 3: 95,585,220 probably null Het
Hydin A T 8: 110,490,673 I1398F possibly damaging Het
Ifnar1 T C 16: 91,505,086 V483A probably benign Het
Ints11 T C 4: 155,886,928 F278L probably damaging Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Krt7 C T 15: 101,413,972 R104C probably damaging Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mef2d T A 3: 88,168,097 I422N probably damaging Het
Mipep G T 14: 60,784,782 R32L probably damaging Het
Mon1a A G 9: 107,902,651 E473G probably damaging Het
Mterf2 T A 10: 85,120,115 Q215L probably damaging Het
Mybpc1 T A 10: 88,555,663 Y324F probably benign Het
Myh11 T C 16: 14,205,954 E1512G probably damaging Het
Myo1g A T 11: 6,515,976 F370I probably damaging Het
Myo5c T A 9: 75,297,509 M1548K possibly damaging Het
Myof T A 19: 37,935,852 I1306F probably damaging Het
Nle1 A G 11: 82,908,192 F21S probably damaging Het
Noc2l C G 4: 156,245,911 D513E probably damaging Het
Olfr23 A T 11: 73,941,202 I319F probably benign Het
Olfr30 A G 11: 58,455,907 V14A probably benign Het
Orc1 T C 4: 108,614,473 *841R probably null Het
Patz1 A G 11: 3,307,720 D573G probably damaging Het
Pcdhga3 A G 18: 37,676,101 T536A probably benign Het
Pde6h C T 6: 136,961,203 T58I possibly damaging Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pkd1 T C 17: 24,586,068 probably null Het
Polr1e G A 4: 45,029,429 A297T probably damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Ryr2 T C 13: 11,714,611 E2375G possibly damaging Het
Ryr2 T C 13: 11,833,992 T361A probably benign Het
Serpina3m T C 12: 104,389,101 I9T probably benign Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Sf3b1 T C 1: 54,999,712 N804S probably benign Het
Shroom1 A G 11: 53,465,172 T350A probably benign Het
Slc24a5 G A 2: 125,068,268 V30I probably benign Het
Slc38a8 A T 8: 119,482,684 probably null Het
Smarcd1 A G 15: 99,707,981 S378G possibly damaging Het
Stx1b T C 7: 127,807,921 I55V probably damaging Het
Sult2a8 A G 7: 14,425,532 V54A probably damaging Het
Tacc2 T C 7: 130,728,777 S264P probably damaging Het
Tbc1d4 A T 14: 101,458,174 Y943N probably damaging Het
Tlr5 T C 1: 182,973,473 I114T probably benign Het
Tmco6 T C 18: 36,735,502 probably null Het
Treh T C 9: 44,682,648 L144P probably damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Ttbk2 A T 2: 120,773,277 F258L possibly damaging Het
Ttn T C 2: 76,955,036 D665G probably damaging Het
Unc93b1 T C 19: 3,942,023 probably null Het
Uroc1 T C 6: 90,345,394 L300P probably damaging Het
Xbp1 A G 11: 5,521,125 E44G probably damaging Het
Zfp457 T A 13: 67,293,278 H315L probably damaging Het
Zfp518a T A 19: 40,915,851 V1408D possibly damaging Het
Zfp52 T G 17: 21,560,403 L171R probably benign Het
Zfp712 C T 13: 67,040,612 C617Y probably damaging Het
Zfp770 T C 2: 114,197,387 N67S probably benign Het
Other mutations in Zfp451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Zfp451 APN 1 33786540 intron probably benign
IGL00423:Zfp451 APN 1 33777579 missense probably benign 0.44
IGL00925:Zfp451 APN 1 33776261 unclassified probably benign
IGL00971:Zfp451 APN 1 33783153 missense probably benign 0.01
IGL01521:Zfp451 APN 1 33777331 unclassified probably null
IGL01672:Zfp451 APN 1 33762166 missense probably benign 0.33
IGL01826:Zfp451 APN 1 33782162 missense probably damaging 1.00
IGL02298:Zfp451 APN 1 33772921 missense probably damaging 0.98
IGL02343:Zfp451 APN 1 33776493 missense probably damaging 1.00
IGL03150:Zfp451 APN 1 33777454 missense probably damaging 1.00
IGL03257:Zfp451 APN 1 33777048 missense possibly damaging 0.90
R0006:Zfp451 UTSW 1 33802780 intron probably benign
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0358:Zfp451 UTSW 1 33777729 missense probably damaging 1.00
R0441:Zfp451 UTSW 1 33777045 missense probably damaging 0.96
R0483:Zfp451 UTSW 1 33770910 splice site probably benign
R0745:Zfp451 UTSW 1 33770848 nonsense probably null
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1486:Zfp451 UTSW 1 33777727 missense probably damaging 0.99
R1774:Zfp451 UTSW 1 33813768 missense probably benign 0.02
R1929:Zfp451 UTSW 1 33782193 missense probably damaging 1.00
R1929:Zfp451 UTSW 1 33783856 missense probably benign 0.12
R1933:Zfp451 UTSW 1 33777822 missense probably damaging 1.00
R2108:Zfp451 UTSW 1 33779167 missense possibly damaging 0.93
R2225:Zfp451 UTSW 1 33770907 splice site probably benign
R2372:Zfp451 UTSW 1 33780052 splice site probably null
R3923:Zfp451 UTSW 1 33779045 missense probably null 1.00
R4295:Zfp451 UTSW 1 33777755 missense probably damaging 0.99
R4409:Zfp451 UTSW 1 33777413 missense probably damaging 1.00
R4617:Zfp451 UTSW 1 33802671 intron probably benign
R4757:Zfp451 UTSW 1 33765858 missense probably damaging 0.98
R4777:Zfp451 UTSW 1 33782105 missense possibly damaging 0.80
R4906:Zfp451 UTSW 1 33805384 missense probably damaging 1.00
R5128:Zfp451 UTSW 1 33802933 intron probably benign
R5129:Zfp451 UTSW 1 33802933 intron probably benign
R5383:Zfp451 UTSW 1 33813806 missense probably damaging 1.00
R5446:Zfp451 UTSW 1 33777528 missense probably damaging 1.00
R6154:Zfp451 UTSW 1 33803546 intron probably benign
R6228:Zfp451 UTSW 1 33803138 intron probably benign
R6272:Zfp451 UTSW 1 33803244 intron probably benign
R6296:Zfp451 UTSW 1 33769817 nonsense probably null
R6321:Zfp451 UTSW 1 33813735 missense probably damaging 1.00
R6445:Zfp451 UTSW 1 33773011 missense probably damaging 1.00
R6528:Zfp451 UTSW 1 33777781 missense probably damaging 1.00
R6562:Zfp451 UTSW 1 33762179 missense possibly damaging 0.90
R6739:Zfp451 UTSW 1 33803594 intron probably benign
R6911:Zfp451 UTSW 1 33803456 intron probably benign
R7042:Zfp451 UTSW 1 33777393 missense probably damaging 1.00
R7044:Zfp451 UTSW 1 33802167 intron probably benign
R7071:Zfp451 UTSW 1 33776744 missense not run
R7082:Zfp451 UTSW 1 33772891 critical splice donor site unknown
R7123:Zfp451 UTSW 1 33776869 missense not run
R7149:Zfp451 UTSW 1 33777324 missense not run
Predicted Primers PCR Primer
(F):5'- GATTCTTCCACCGAGTTCGC -3'
(R):5'- CACTGATTGATGTTTTCAGAAGTGTGC -3'

Sequencing Primer
(F):5'- TTCCACCGAGTTCGCAAGTG -3'
(R):5'- GTACTTTAAGATGATAGAGTGTGTT -3'
Posted On2016-12-05