Incidental Mutation 'R5776:Sctr'
ID446674
Institutional Source Beutler Lab
Gene Symbol Sctr
Ensembl Gene ENSMUSG00000026387
Gene Namesecretin receptor
Synonyms6530402O03Rik
MMRRC Submission 043375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5776 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location120006894-120063536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120056407 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 357 (S357P)
Ref Sequence ENSEMBL: ENSMUSP00000072660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072886] [ENSMUST00000189037]
Predicted Effect probably damaging
Transcript: ENSMUST00000072886
AA Change: S357P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072660
Gene: ENSMUSG00000026387
AA Change: S357P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 76 146 5.18e-21 SMART
Pfam:7tm_2 153 398 3.8e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189037
AA Change: S342P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139932
Gene: ENSMUSG00000026387
AA Change: S342P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 61 131 2.59e-21 SMART
Pfam:7tm_2 138 383 1.9e-89 PFAM
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and belongs to the glucagon-VIP-secretin receptor family. It binds secretin which is the most potent regulator of pancreatic bicarbonate, electrolyte and volume secretion. Secretin and its receptor are suggested to be involved in pancreatic cancer and autism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show polydipsia, polyuria, decreased urine osmolality, higher serum glucose levels, kidney glomerular and tubular pathology, and impaired renal water reabsorption. Homozygotes for a different null allele show impaired synaptic plasticity and social behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,107,650 M378K possibly damaging Het
Abca17 A G 17: 24,295,158 V857A probably benign Het
Abca9 C T 11: 110,107,460 probably null Het
Adam22 T C 5: 8,127,361 K583E probably benign Het
Akr1c13 T C 13: 4,194,187 F80L probably damaging Het
Apob A T 12: 8,006,149 I1511F possibly damaging Het
Cfh C A 1: 140,144,023 R291I possibly damaging Het
Col1a1 C T 11: 94,949,724 S1114F unknown Het
Ctsj T C 13: 61,003,142 D168G probably damaging Het
Erf T C 7: 25,246,109 D79G probably damaging Het
Extl1 T C 4: 134,357,772 N629S possibly damaging Het
Fbxo9 T C 9: 78,095,187 E204G probably damaging Het
Fdx1l C A 9: 21,073,482 V9L possibly damaging Het
Gfer G T 17: 24,696,053 S5R probably benign Het
Gm15931 A T 7: 4,281,565 noncoding transcript Het
Gm6309 T A 5: 146,168,881 I158F possibly damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8251 T C 1: 44,056,505 E1811G possibly damaging Het
Hacl1 A T 14: 31,622,871 N234K possibly damaging Het
Hcn3 C T 3: 89,148,105 A612T probably benign Het
Hectd1 T A 12: 51,764,114 E1679D possibly damaging Het
Hipk4 T C 7: 27,528,980 L285P probably damaging Het
Igsf3 G A 3: 101,425,480 V25I probably benign Het
Jade1 A G 3: 41,613,792 H765R probably benign Het
Kcnv1 T C 15: 45,114,567 D25G unknown Het
Klhl3 A G 13: 58,005,184 S586P probably benign Het
L3mbtl2 A G 15: 81,684,871 D582G probably damaging Het
Matn2 G A 15: 34,431,619 C835Y probably damaging Het
Mgea5 T C 19: 45,771,924 E265G probably damaging Het
Naa15 A C 3: 51,460,026 D490A probably damaging Het
Nab2 T A 10: 127,664,329 Y298F probably damaging Het
Nipsnap1 T A 11: 4,888,919 M115K probably benign Het
Nlrp5-ps T C 7: 14,592,724 noncoding transcript Het
Nol4l T G 2: 153,417,821 Q211P probably damaging Het
Olfr427 A T 1: 174,099,773 H105L probably damaging Het
Olfr625-ps1 T A 7: 103,683,039 M97K probably damaging Het
Pkhd1 T C 1: 20,209,185 K2970E possibly damaging Het
Plin4 T C 17: 56,104,983 T683A probably damaging Het
Ppm1g T C 5: 31,205,110 D282G probably benign Het
Ppp6r3 A G 19: 3,526,901 S10P possibly damaging Het
Raph1 G A 1: 60,490,156 probably benign Het
Rc3h2 A G 2: 37,378,313 V935A possibly damaging Het
Reg4 T A 3: 98,233,028 D108E possibly damaging Het
Saraf T A 8: 34,165,450 Y228N probably damaging Het
Sec22b A T 3: 97,914,568 N139Y probably damaging Het
Sgsm1 T A 5: 113,250,957 I1037F probably damaging Het
Skint5 A C 4: 113,763,503 S671R unknown Het
Slc38a3 C A 9: 107,658,749 E62* probably null Het
Slfn14 C T 11: 83,283,599 E189K probably damaging Het
Sox21 A G 14: 118,235,244 L131P probably damaging Het
Stip1 A G 19: 7,022,025 probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Susd1 T C 4: 59,315,363 probably benign Het
Tdrd7 T A 4: 46,005,689 D498E probably benign Het
Tln2 C T 9: 67,258,250 E1053K probably damaging Het
Trav6-4 A G 14: 53,454,754 D103G probably damaging Het
Txndc15 A G 13: 55,718,107 E128G probably benign Het
Vmn2r22 A T 6: 123,637,714 W306R probably damaging Het
Yjefn3 A T 8: 69,889,471 L33Q probably damaging Het
Zfp641 T C 15: 98,289,010 D244G probably damaging Het
Other mutations in Sctr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Sctr APN 1 120044720 missense probably damaging 1.00
IGL01542:Sctr APN 1 120044769 splice site probably benign
IGL02798:Sctr APN 1 120022180 missense probably damaging 1.00
IGL02850:Sctr APN 1 120044663 missense possibly damaging 0.95
IGL02850:Sctr APN 1 120022179 missense probably damaging 1.00
IGL03256:Sctr APN 1 120031559 splice site probably benign
PIT4677001:Sctr UTSW 1 120061904 missense probably damaging 1.00
R0018:Sctr UTSW 1 120043556 splice site probably benign
R0166:Sctr UTSW 1 120055394 missense probably damaging 0.97
R1678:Sctr UTSW 1 120036439 critical splice donor site probably null
R1728:Sctr UTSW 1 120031656 missense probably benign 0.00
R1728:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1729:Sctr UTSW 1 120031656 missense probably benign 0.00
R1729:Sctr UTSW 1 120063246 missense probably benign 0.16
R1729:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1730:Sctr UTSW 1 120031656 missense probably benign 0.00
R1730:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1739:Sctr UTSW 1 120031656 missense probably benign 0.00
R1739:Sctr UTSW 1 120063246 missense probably benign 0.16
R1739:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1762:Sctr UTSW 1 120031656 missense probably benign 0.00
R1762:Sctr UTSW 1 120063246 missense probably benign 0.16
R1762:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1783:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120063246 missense probably benign 0.16
R1785:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R2116:Sctr UTSW 1 120031582 missense probably damaging 1.00
R5522:Sctr UTSW 1 120036416 missense probably benign 0.10
R5781:Sctr UTSW 1 120031620 missense probably damaging 0.99
R6333:Sctr UTSW 1 120056452 missense probably damaging 1.00
R7084:Sctr UTSW 1 120063271 missense possibly damaging 0.77
R7263:Sctr UTSW 1 120022225 missense probably benign
R7265:Sctr UTSW 1 120022225 missense probably benign
R7266:Sctr UTSW 1 120022225 missense probably benign
R7304:Sctr UTSW 1 120022240 missense probably damaging 1.00
X0067:Sctr UTSW 1 120007299 missense probably benign
Z1088:Sctr UTSW 1 120036406 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTGATGGGTACACAAATAAGTGAC -3'
(R):5'- AGGCTTGCTAACTCTGCAGC -3'

Sequencing Primer
(F):5'- TAAGTGACAAATATGGATAGACAGGC -3'
(R):5'- CATCACTGGGATTTTAGGCATGCAC -3'
Posted On2016-12-15