Incidental Mutation 'R5776:Olfr427'
ID446676
Institutional Source Beutler Lab
Gene Symbol Olfr427
Ensembl Gene ENSMUSG00000059371
Gene Nameolfactory receptor 427
SynonymsMOR105-7, MOR105-9, GA_x6K02T2P20D-21075927-21074980
MMRRC Submission 043375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5776 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174096891-174103224 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 174099773 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 105 (H105L)
Ref Sequence ENSEMBL: ENSMUSP00000149570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080831] [ENSMUST00000213832]
Predicted Effect probably damaging
Transcript: ENSMUST00000080831
AA Change: H105L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079644
Gene: ENSMUSG00000059371
AA Change: H105L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-58 PFAM
Pfam:7tm_1 41 289 3.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201135
Predicted Effect probably damaging
Transcript: ENSMUST00000213832
AA Change: H105L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0216 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,107,650 M378K possibly damaging Het
Abca17 A G 17: 24,295,158 V857A probably benign Het
Abca9 C T 11: 110,107,460 probably null Het
Adam22 T C 5: 8,127,361 K583E probably benign Het
Akr1c13 T C 13: 4,194,187 F80L probably damaging Het
Apob A T 12: 8,006,149 I1511F possibly damaging Het
Cfh C A 1: 140,144,023 R291I possibly damaging Het
Col1a1 C T 11: 94,949,724 S1114F unknown Het
Ctsj T C 13: 61,003,142 D168G probably damaging Het
Erf T C 7: 25,246,109 D79G probably damaging Het
Extl1 T C 4: 134,357,772 N629S possibly damaging Het
Fbxo9 T C 9: 78,095,187 E204G probably damaging Het
Fdx1l C A 9: 21,073,482 V9L possibly damaging Het
Gfer G T 17: 24,696,053 S5R probably benign Het
Gm15931 A T 7: 4,281,565 noncoding transcript Het
Gm6309 T A 5: 146,168,881 I158F possibly damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8251 T C 1: 44,056,505 E1811G possibly damaging Het
Hacl1 A T 14: 31,622,871 N234K possibly damaging Het
Hcn3 C T 3: 89,148,105 A612T probably benign Het
Hectd1 T A 12: 51,764,114 E1679D possibly damaging Het
Hipk4 T C 7: 27,528,980 L285P probably damaging Het
Igsf3 G A 3: 101,425,480 V25I probably benign Het
Jade1 A G 3: 41,613,792 H765R probably benign Het
Kcnv1 T C 15: 45,114,567 D25G unknown Het
Klhl3 A G 13: 58,005,184 S586P probably benign Het
L3mbtl2 A G 15: 81,684,871 D582G probably damaging Het
Matn2 G A 15: 34,431,619 C835Y probably damaging Het
Mgea5 T C 19: 45,771,924 E265G probably damaging Het
Naa15 A C 3: 51,460,026 D490A probably damaging Het
Nab2 T A 10: 127,664,329 Y298F probably damaging Het
Nipsnap1 T A 11: 4,888,919 M115K probably benign Het
Nlrp5-ps T C 7: 14,592,724 noncoding transcript Het
Nol4l T G 2: 153,417,821 Q211P probably damaging Het
Olfr625-ps1 T A 7: 103,683,039 M97K probably damaging Het
Pkhd1 T C 1: 20,209,185 K2970E possibly damaging Het
Plin4 T C 17: 56,104,983 T683A probably damaging Het
Ppm1g T C 5: 31,205,110 D282G probably benign Het
Ppp6r3 A G 19: 3,526,901 S10P possibly damaging Het
Raph1 G A 1: 60,490,156 probably benign Het
Rc3h2 A G 2: 37,378,313 V935A possibly damaging Het
Reg4 T A 3: 98,233,028 D108E possibly damaging Het
Saraf T A 8: 34,165,450 Y228N probably damaging Het
Sctr T C 1: 120,056,407 S357P probably damaging Het
Sec22b A T 3: 97,914,568 N139Y probably damaging Het
Sgsm1 T A 5: 113,250,957 I1037F probably damaging Het
Skint5 A C 4: 113,763,503 S671R unknown Het
Slc38a3 C A 9: 107,658,749 E62* probably null Het
Slfn14 C T 11: 83,283,599 E189K probably damaging Het
Sox21 A G 14: 118,235,244 L131P probably damaging Het
Stip1 A G 19: 7,022,025 probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Susd1 T C 4: 59,315,363 probably benign Het
Tdrd7 T A 4: 46,005,689 D498E probably benign Het
Tln2 C T 9: 67,258,250 E1053K probably damaging Het
Trav6-4 A G 14: 53,454,754 D103G probably damaging Het
Txndc15 A G 13: 55,718,107 E128G probably benign Het
Vmn2r22 A T 6: 123,637,714 W306R probably damaging Het
Yjefn3 A T 8: 69,889,471 L33Q probably damaging Het
Zfp641 T C 15: 98,289,010 D244G probably damaging Het
Other mutations in Olfr427
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Olfr427 APN 1 174100367 missense probably benign
IGL01804:Olfr427 APN 1 174099835 missense probably damaging 1.00
IGL02573:Olfr427 APN 1 174100130 missense possibly damaging 0.94
IGL02736:Olfr427 APN 1 174099647 missense probably damaging 0.99
R0012:Olfr427 UTSW 1 174100207 missense probably damaging 1.00
R0437:Olfr427 UTSW 1 174100399 missense probably benign 0.04
R0688:Olfr427 UTSW 1 174100064 missense probably damaging 1.00
R1473:Olfr427 UTSW 1 174099749 missense probably damaging 1.00
R1754:Olfr427 UTSW 1 174100033 missense probably benign 0.24
R5453:Olfr427 UTSW 1 174099467 missense probably benign
R6700:Olfr427 UTSW 1 174099839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTGCAGCTGGATGTCCG -3'
(R):5'- AGGAGCACAGGTTCTAAGTCAC -3'

Sequencing Primer
(F):5'- GGATGTCCGTCTGCACAATC -3'
(R):5'- GAGTAGATATCCACACAATCTCTGGG -3'
Posted On2016-12-15