Incidental Mutation 'R5776:Igsf3'
ID446687
Institutional Source Beutler Lab
Gene Symbol Igsf3
Ensembl Gene ENSMUSG00000042035
Gene Nameimmunoglobulin superfamily, member 3
Synonyms1700016K10Rik, 4833439O17Rik, 2810035F16Rik
MMRRC Submission 043375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R5776 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location101377083-101463059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101425480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 25 (V25I)
Ref Sequence ENSEMBL: ENSMUSP00000141823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043983] [ENSMUST00000195164]
Predicted Effect probably benign
Transcript: ENSMUST00000043983
AA Change: V25I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048900
Gene: ENSMUSG00000042035
AA Change: V25I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 7.7e-5 SMART
IG 152 275 1.99e-7 SMART
IG 287 405 1.79e0 SMART
IG 417 539 6.26e-5 SMART
IG 553 674 3.16e-1 SMART
IG 686 811 4.89e-7 SMART
IG 823 947 8.38e-6 SMART
IG 959 1109 6.97e-3 SMART
transmembrane domain 1125 1147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195164
AA Change: V25I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141823
Gene: ENSMUSG00000042035
AA Change: V25I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 3.1e-7 SMART
IG 152 275 8.2e-10 SMART
IG 287 405 7.4e-3 SMART
IG 437 559 2.5e-7 SMART
IG 573 694 1.3e-3 SMART
IG 706 831 1.9e-9 SMART
IG 843 967 3.4e-8 SMART
IG 979 1129 2.9e-5 SMART
transmembrane domain 1145 1167 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199431
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an immunoglobulin-like membrane protein containing several V-type Ig-like domains. A mutation in this gene has been associated with bilateral nasolacrimal duct obstruction (LCDD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,107,650 M378K possibly damaging Het
Abca17 A G 17: 24,295,158 V857A probably benign Het
Abca9 C T 11: 110,107,460 probably null Het
Adam22 T C 5: 8,127,361 K583E probably benign Het
Akr1c13 T C 13: 4,194,187 F80L probably damaging Het
Apob A T 12: 8,006,149 I1511F possibly damaging Het
Cfh C A 1: 140,144,023 R291I possibly damaging Het
Col1a1 C T 11: 94,949,724 S1114F unknown Het
Ctsj T C 13: 61,003,142 D168G probably damaging Het
Erf T C 7: 25,246,109 D79G probably damaging Het
Extl1 T C 4: 134,357,772 N629S possibly damaging Het
Fbxo9 T C 9: 78,095,187 E204G probably damaging Het
Fdx1l C A 9: 21,073,482 V9L possibly damaging Het
Gfer G T 17: 24,696,053 S5R probably benign Het
Gm15931 A T 7: 4,281,565 noncoding transcript Het
Gm6309 T A 5: 146,168,881 I158F possibly damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8251 T C 1: 44,056,505 E1811G possibly damaging Het
Hacl1 A T 14: 31,622,871 N234K possibly damaging Het
Hcn3 C T 3: 89,148,105 A612T probably benign Het
Hectd1 T A 12: 51,764,114 E1679D possibly damaging Het
Hipk4 T C 7: 27,528,980 L285P probably damaging Het
Jade1 A G 3: 41,613,792 H765R probably benign Het
Kcnv1 T C 15: 45,114,567 D25G unknown Het
Klhl3 A G 13: 58,005,184 S586P probably benign Het
L3mbtl2 A G 15: 81,684,871 D582G probably damaging Het
Matn2 G A 15: 34,431,619 C835Y probably damaging Het
Mgea5 T C 19: 45,771,924 E265G probably damaging Het
Naa15 A C 3: 51,460,026 D490A probably damaging Het
Nab2 T A 10: 127,664,329 Y298F probably damaging Het
Nipsnap1 T A 11: 4,888,919 M115K probably benign Het
Nlrp5-ps T C 7: 14,592,724 noncoding transcript Het
Nol4l T G 2: 153,417,821 Q211P probably damaging Het
Olfr427 A T 1: 174,099,773 H105L probably damaging Het
Olfr625-ps1 T A 7: 103,683,039 M97K probably damaging Het
Pkhd1 T C 1: 20,209,185 K2970E possibly damaging Het
Plin4 T C 17: 56,104,983 T683A probably damaging Het
Ppm1g T C 5: 31,205,110 D282G probably benign Het
Ppp6r3 A G 19: 3,526,901 S10P possibly damaging Het
Raph1 G A 1: 60,490,156 probably benign Het
Rc3h2 A G 2: 37,378,313 V935A possibly damaging Het
Reg4 T A 3: 98,233,028 D108E possibly damaging Het
Saraf T A 8: 34,165,450 Y228N probably damaging Het
Sctr T C 1: 120,056,407 S357P probably damaging Het
Sec22b A T 3: 97,914,568 N139Y probably damaging Het
Sgsm1 T A 5: 113,250,957 I1037F probably damaging Het
Skint5 A C 4: 113,763,503 S671R unknown Het
Slc38a3 C A 9: 107,658,749 E62* probably null Het
Slfn14 C T 11: 83,283,599 E189K probably damaging Het
Sox21 A G 14: 118,235,244 L131P probably damaging Het
Stip1 A G 19: 7,022,025 probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Susd1 T C 4: 59,315,363 probably benign Het
Tdrd7 T A 4: 46,005,689 D498E probably benign Het
Tln2 C T 9: 67,258,250 E1053K probably damaging Het
Trav6-4 A G 14: 53,454,754 D103G probably damaging Het
Txndc15 A G 13: 55,718,107 E128G probably benign Het
Vmn2r22 A T 6: 123,637,714 W306R probably damaging Het
Yjefn3 A T 8: 69,889,471 L33Q probably damaging Het
Zfp641 T C 15: 98,289,010 D244G probably damaging Het
Other mutations in Igsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Igsf3 APN 3 101431239 missense probably damaging 0.99
IGL00907:Igsf3 APN 3 101427448 splice site probably benign
IGL01321:Igsf3 APN 3 101427022 splice site probably benign
IGL01340:Igsf3 APN 3 101439679 nonsense probably null
IGL02291:Igsf3 APN 3 101439529 missense probably damaging 1.00
PIT4402001:Igsf3 UTSW 3 101427077 missense probably benign 0.00
R0090:Igsf3 UTSW 3 101435652 missense probably damaging 1.00
R0143:Igsf3 UTSW 3 101435601 missense probably damaging 1.00
R0418:Igsf3 UTSW 3 101435435 missense probably damaging 0.99
R0711:Igsf3 UTSW 3 101427393 missense probably benign 0.31
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1384:Igsf3 UTSW 3 101451296 critical splice donor site probably null
R1594:Igsf3 UTSW 3 101451077 nonsense probably null
R1624:Igsf3 UTSW 3 101455227 missense probably benign 0.37
R1766:Igsf3 UTSW 3 101431282 missense probably damaging 1.00
R1988:Igsf3 UTSW 3 101431296 missense probably benign 0.03
R2072:Igsf3 UTSW 3 101439515 missense probably benign 0.02
R4707:Igsf3 UTSW 3 101458094 missense probably benign 0.06
R4976:Igsf3 UTSW 3 101439361 splice site probably null
R4982:Igsf3 UTSW 3 101435667 missense probably benign 0.42
R5008:Igsf3 UTSW 3 101450917 missense probably damaging 0.97
R5119:Igsf3 UTSW 3 101439361 splice site probably null
R5189:Igsf3 UTSW 3 101431527 missense possibly damaging 0.64
R5456:Igsf3 UTSW 3 101427221 missense probably benign 0.20
R6112:Igsf3 UTSW 3 101451006 missense probably damaging 1.00
R6383:Igsf3 UTSW 3 101435648 missense probably benign 0.05
R6758:Igsf3 UTSW 3 101425498 missense probably damaging 0.98
R7085:Igsf3 UTSW 3 101455489 missense probably benign 0.12
R7310:Igsf3 UTSW 3 101431579 missense probably benign 0.01
R7470:Igsf3 UTSW 3 101451075 missense possibly damaging 0.67
X0027:Igsf3 UTSW 3 101435645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCACAAAGTGCCTTGGAAAG -3'
(R):5'- TGACATTCATACTCGCCGGC -3'

Sequencing Primer
(F):5'- GGGCCAGTAACCTACTTATACTG -3'
(R):5'- TAGATCTTCCCACCGCGGAC -3'
Posted On2016-12-15