Incidental Mutation 'R5776:Gm6309'
ID446695
Institutional Source Beutler Lab
Gene Symbol Gm6309
Ensembl Gene ENSMUSG00000096798
Gene Namepredicted gene 6309
Synonyms
MMRRC Submission 043375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5776 (G1)
Quality Score204
Status Not validated
Chromosome5
Chromosomal Location146167976-146170721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146168881 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 158 (I158F)
Ref Sequence ENSEMBL: ENSMUSP00000134203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174320]
Predicted Effect possibly damaging
Transcript: ENSMUST00000174320
AA Change: I158F

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134203
Gene: ENSMUSG00000096798
AA Change: I158F

DomainStartEndE-ValueType
RasGEFN 65 181 3.29e-3 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,107,650 M378K possibly damaging Het
Abca17 A G 17: 24,295,158 V857A probably benign Het
Abca9 C T 11: 110,107,460 probably null Het
Adam22 T C 5: 8,127,361 K583E probably benign Het
Akr1c13 T C 13: 4,194,187 F80L probably damaging Het
Apob A T 12: 8,006,149 I1511F possibly damaging Het
Cfh C A 1: 140,144,023 R291I possibly damaging Het
Col1a1 C T 11: 94,949,724 S1114F unknown Het
Ctsj T C 13: 61,003,142 D168G probably damaging Het
Erf T C 7: 25,246,109 D79G probably damaging Het
Extl1 T C 4: 134,357,772 N629S possibly damaging Het
Fbxo9 T C 9: 78,095,187 E204G probably damaging Het
Fdx1l C A 9: 21,073,482 V9L possibly damaging Het
Gfer G T 17: 24,696,053 S5R probably benign Het
Gm15931 A T 7: 4,281,565 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8251 T C 1: 44,056,505 E1811G possibly damaging Het
Hacl1 A T 14: 31,622,871 N234K possibly damaging Het
Hcn3 C T 3: 89,148,105 A612T probably benign Het
Hectd1 T A 12: 51,764,114 E1679D possibly damaging Het
Hipk4 T C 7: 27,528,980 L285P probably damaging Het
Igsf3 G A 3: 101,425,480 V25I probably benign Het
Jade1 A G 3: 41,613,792 H765R probably benign Het
Kcnv1 T C 15: 45,114,567 D25G unknown Het
Klhl3 A G 13: 58,005,184 S586P probably benign Het
L3mbtl2 A G 15: 81,684,871 D582G probably damaging Het
Matn2 G A 15: 34,431,619 C835Y probably damaging Het
Mgea5 T C 19: 45,771,924 E265G probably damaging Het
Naa15 A C 3: 51,460,026 D490A probably damaging Het
Nab2 T A 10: 127,664,329 Y298F probably damaging Het
Nipsnap1 T A 11: 4,888,919 M115K probably benign Het
Nlrp5-ps T C 7: 14,592,724 noncoding transcript Het
Nol4l T G 2: 153,417,821 Q211P probably damaging Het
Olfr427 A T 1: 174,099,773 H105L probably damaging Het
Olfr625-ps1 T A 7: 103,683,039 M97K probably damaging Het
Pkhd1 T C 1: 20,209,185 K2970E possibly damaging Het
Plin4 T C 17: 56,104,983 T683A probably damaging Het
Ppm1g T C 5: 31,205,110 D282G probably benign Het
Ppp6r3 A G 19: 3,526,901 S10P possibly damaging Het
Raph1 G A 1: 60,490,156 probably benign Het
Rc3h2 A G 2: 37,378,313 V935A possibly damaging Het
Reg4 T A 3: 98,233,028 D108E possibly damaging Het
Saraf T A 8: 34,165,450 Y228N probably damaging Het
Sctr T C 1: 120,056,407 S357P probably damaging Het
Sec22b A T 3: 97,914,568 N139Y probably damaging Het
Sgsm1 T A 5: 113,250,957 I1037F probably damaging Het
Skint5 A C 4: 113,763,503 S671R unknown Het
Slc38a3 C A 9: 107,658,749 E62* probably null Het
Slfn14 C T 11: 83,283,599 E189K probably damaging Het
Sox21 A G 14: 118,235,244 L131P probably damaging Het
Stip1 A G 19: 7,022,025 probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Susd1 T C 4: 59,315,363 probably benign Het
Tdrd7 T A 4: 46,005,689 D498E probably benign Het
Tln2 C T 9: 67,258,250 E1053K probably damaging Het
Trav6-4 A G 14: 53,454,754 D103G probably damaging Het
Txndc15 A G 13: 55,718,107 E128G probably benign Het
Vmn2r22 A T 6: 123,637,714 W306R probably damaging Het
Yjefn3 A T 8: 69,889,471 L33Q probably damaging Het
Zfp641 T C 15: 98,289,010 D244G probably damaging Het
Other mutations in Gm6309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Gm6309 APN 5 146168411 missense probably benign 0.02
IGL01835:Gm6309 APN 5 146168275 missense probably damaging 0.99
FR4737:Gm6309 UTSW 5 146168183 missense probably benign
FR4976:Gm6309 UTSW 5 146168183 missense probably benign
R1513:Gm6309 UTSW 5 146170583 missense possibly damaging 0.83
R2022:Gm6309 UTSW 5 146168311 missense probably benign
R2191:Gm6309 UTSW 5 146168871 missense possibly damaging 0.93
R4735:Gm6309 UTSW 5 146168244 missense probably damaging 0.99
R5719:Gm6309 UTSW 5 146168182 missense probably benign 0.01
R5833:Gm6309 UTSW 5 146168318 missense probably damaging 1.00
R6246:Gm6309 UTSW 5 146170240 missense probably damaging 1.00
R6373:Gm6309 UTSW 5 146170275 missense probably damaging 0.97
R6873:Gm6309 UTSW 5 146168188 missense probably damaging 0.96
R6912:Gm6309 UTSW 5 146168830 missense probably damaging 0.97
R6954:Gm6309 UTSW 5 146168490 missense possibly damaging 0.82
R7145:Gm6309 UTSW 5 146170290 missense possibly damaging 0.74
R7258:Gm6309 UTSW 5 146168296 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGCCAAAGCTCTGGAGAATAC -3'
(R):5'- ACTATGCTCATCTGCAGACAGG -3'

Sequencing Primer
(F):5'- TCTGGAGAATACCCTGCTGGAATC -3'
(R):5'- ACAGGCTGGCAGGCATTAC -3'
Posted On2016-12-15