Incidental Mutation 'R5776:Hipk4'
ID446701
Institutional Source Beutler Lab
Gene Symbol Hipk4
Ensembl Gene ENSMUSG00000040424
Gene Namehomeodomain interacting protein kinase 4
SynonymsLOC233020
MMRRC Submission 043375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5776 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27523267-27531175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27528980 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 285 (L285P)
Ref Sequence ENSEMBL: ENSMUSP00000103990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037134] [ENSMUST00000108353] [ENSMUST00000117095] [ENSMUST00000117611]
Predicted Effect probably damaging
Transcript: ENSMUST00000037134
AA Change: L81P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043175
Gene: ENSMUSG00000040424
AA Change: L81P

DomainStartEndE-ValueType
SCOP:d1howa_ 1 142 8e-12 SMART
Blast:S_TKc 1 143 8e-99 BLAST
PDB:3ANR|D 1 155 1e-12 PDB
low complexity region 192 206 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108353
AA Change: L285P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424
AA Change: L285P

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117095
SMART Domains Protein: ENSMUSP00000113820
Gene: ENSMUSG00000003363

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
Pfam:PLDc_3 224 401 1.6e-43 PFAM
PLDc 409 435 1.19e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117611
SMART Domains Protein: ENSMUSP00000112942
Gene: ENSMUSG00000003363

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
low complexity region 285 297 N/A INTRINSIC
PLDc 409 435 1.19e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155287
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeodomain interacting protein kinase (HIPK) family of proteins. While other members of this family are found throughout vertebrates, this member is present only in mammals. Compared to other members of this family, the encoded protein lacks a nuclear localization signal and a C-terminal autoinhibitory domain. The encoded protein exhibits kinase activity and may phosphorylate the tumor suppressor protein p53. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,107,650 M378K possibly damaging Het
Abca17 A G 17: 24,295,158 V857A probably benign Het
Abca9 C T 11: 110,107,460 probably null Het
Adam22 T C 5: 8,127,361 K583E probably benign Het
Akr1c13 T C 13: 4,194,187 F80L probably damaging Het
Apob A T 12: 8,006,149 I1511F possibly damaging Het
Cfh C A 1: 140,144,023 R291I possibly damaging Het
Col1a1 C T 11: 94,949,724 S1114F unknown Het
Ctsj T C 13: 61,003,142 D168G probably damaging Het
Erf T C 7: 25,246,109 D79G probably damaging Het
Extl1 T C 4: 134,357,772 N629S possibly damaging Het
Fbxo9 T C 9: 78,095,187 E204G probably damaging Het
Fdx1l C A 9: 21,073,482 V9L possibly damaging Het
Gfer G T 17: 24,696,053 S5R probably benign Het
Gm15931 A T 7: 4,281,565 noncoding transcript Het
Gm6309 T A 5: 146,168,881 I158F possibly damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8251 T C 1: 44,056,505 E1811G possibly damaging Het
Hacl1 A T 14: 31,622,871 N234K possibly damaging Het
Hcn3 C T 3: 89,148,105 A612T probably benign Het
Hectd1 T A 12: 51,764,114 E1679D possibly damaging Het
Igsf3 G A 3: 101,425,480 V25I probably benign Het
Jade1 A G 3: 41,613,792 H765R probably benign Het
Kcnv1 T C 15: 45,114,567 D25G unknown Het
Klhl3 A G 13: 58,005,184 S586P probably benign Het
L3mbtl2 A G 15: 81,684,871 D582G probably damaging Het
Matn2 G A 15: 34,431,619 C835Y probably damaging Het
Mgea5 T C 19: 45,771,924 E265G probably damaging Het
Naa15 A C 3: 51,460,026 D490A probably damaging Het
Nab2 T A 10: 127,664,329 Y298F probably damaging Het
Nipsnap1 T A 11: 4,888,919 M115K probably benign Het
Nlrp5-ps T C 7: 14,592,724 noncoding transcript Het
Nol4l T G 2: 153,417,821 Q211P probably damaging Het
Olfr427 A T 1: 174,099,773 H105L probably damaging Het
Olfr625-ps1 T A 7: 103,683,039 M97K probably damaging Het
Pkhd1 T C 1: 20,209,185 K2970E possibly damaging Het
Plin4 T C 17: 56,104,983 T683A probably damaging Het
Ppm1g T C 5: 31,205,110 D282G probably benign Het
Ppp6r3 A G 19: 3,526,901 S10P possibly damaging Het
Raph1 G A 1: 60,490,156 probably benign Het
Rc3h2 A G 2: 37,378,313 V935A possibly damaging Het
Reg4 T A 3: 98,233,028 D108E possibly damaging Het
Saraf T A 8: 34,165,450 Y228N probably damaging Het
Sctr T C 1: 120,056,407 S357P probably damaging Het
Sec22b A T 3: 97,914,568 N139Y probably damaging Het
Sgsm1 T A 5: 113,250,957 I1037F probably damaging Het
Skint5 A C 4: 113,763,503 S671R unknown Het
Slc38a3 C A 9: 107,658,749 E62* probably null Het
Slfn14 C T 11: 83,283,599 E189K probably damaging Het
Sox21 A G 14: 118,235,244 L131P probably damaging Het
Stip1 A G 19: 7,022,025 probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Susd1 T C 4: 59,315,363 probably benign Het
Tdrd7 T A 4: 46,005,689 D498E probably benign Het
Tln2 C T 9: 67,258,250 E1053K probably damaging Het
Trav6-4 A G 14: 53,454,754 D103G probably damaging Het
Txndc15 A G 13: 55,718,107 E128G probably benign Het
Vmn2r22 A T 6: 123,637,714 W306R probably damaging Het
Yjefn3 A T 8: 69,889,471 L33Q probably damaging Het
Zfp641 T C 15: 98,289,010 D244G probably damaging Het
Other mutations in Hipk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Hipk4 APN 7 27528543 nonsense probably null
IGL02712:Hipk4 APN 7 27528635 missense probably damaging 1.00
R2018:Hipk4 UTSW 7 27529004 missense probably damaging 1.00
R3813:Hipk4 UTSW 7 27523947 missense probably damaging 1.00
R4796:Hipk4 UTSW 7 27528570 missense probably benign 0.00
R5121:Hipk4 UTSW 7 27529492 missense probably benign 0.02
R5738:Hipk4 UTSW 7 27528416 missense probably damaging 1.00
R6142:Hipk4 UTSW 7 27529165 missense probably damaging 1.00
R6578:Hipk4 UTSW 7 27528387 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATCCTCCCTGTAGCAGTGGG -3'
(R):5'- CTTGTCCTCCCTGAAGAAGG -3'

Sequencing Primer
(F):5'- CCCTGTAGCAGTGGGAGAGTG -3'
(R):5'- TGAAGAAGGACCCACTGCCTG -3'
Posted On2016-12-15